Incidental Mutation 'R9262:Epha8'
ID 702302
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene Name Eph receptor A8
Synonyms EphA8, Hek3, Eek
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9262 (G1)
Quality Score 206.009
Status Validated
Chromosome 4
Chromosomal Location 136929419-136956816 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 136931684 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 886 (H886Q)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
AlphaFold O09127
Predicted Effect probably benign
Transcript: ENSMUST00000030420
AA Change: H886Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: H886Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,588 M473V probably benign Het
4933409G03Rik A T 2: 68,613,031 H192L unknown Het
Abca4 T A 3: 122,170,990 C2149S probably damaging Het
Abl2 G A 1: 156,642,250 G1028D possibly damaging Het
Adgre1 A G 17: 57,447,941 T680A probably damaging Het
Amn G A 12: 111,271,151 W10* probably null Het
Ankhd1 G T 18: 36,632,746 V140F Het
Asnsd1 A T 1: 53,344,775 N613K probably benign Het
Bbs2 A T 8: 94,080,915 I417N probably damaging Het
Cad T A 5: 31,067,665 W971R probably null Het
Cand2 A T 6: 115,782,769 I134F probably benign Het
Ccdc154 C A 17: 25,170,186 H453N probably damaging Het
Ccdc7a T A 8: 128,759,796 H1601L possibly damaging Het
Ccdc9 A C 7: 16,278,475 S261A probably benign Het
Cdkl3 T A 11: 52,025,875 S277T probably benign Het
Cipc T A 12: 86,952,723 Y8* probably null Het
Cramp1l A G 17: 25,013,946 S27P probably damaging Het
Csf1r A T 18: 61,110,334 M141L probably benign Het
Csf2rb2 G T 15: 78,284,335 F873L probably damaging Het
Dchs1 G A 7: 105,755,626 R2570W probably damaging Het
Dmxl1 A T 18: 49,843,852 N94Y probably benign Het
Dnajc10 A G 2: 80,346,621 K640R probably benign Het
Fcgbp G C 7: 28,120,527 D2560H probably damaging Het
Fry T G 5: 150,381,644 F605V probably damaging Het
Fsip2 A G 2: 82,977,318 N1327S probably benign Het
Gm12117 T C 11: 33,276,001 T112A probably benign Het
Gm3604 A T 13: 62,369,883 N220K probably damaging Het
Gm572 T C 4: 148,651,195 V27A probably benign Het
Gm6614 G T 6: 141,980,868 F597L probably damaging Het
Gm8251 A G 1: 44,057,109 S1610P possibly damaging Het
Gm853 A G 4: 130,220,360 V88A possibly damaging Het
Gpr39 A G 1: 125,872,787 K425R probably benign Het
Heatr3 A G 8: 88,156,469 D349G probably benign Het
Hip1 A G 5: 135,449,687 S248P probably damaging Het
Itga11 A G 9: 62,752,396 probably benign Het
Itga3 C T 11: 95,065,799 V210I probably benign Het
Jmjd1c T C 10: 67,248,014 I2173T probably benign Het
Klf13 G A 7: 63,924,708 Q21* probably null Het
Kmt2a A T 9: 44,819,925 S3032T probably benign Het
Krt34 T C 11: 100,040,025 R184G probably benign Het
Krtap16-1 T C 11: 99,986,168 T137A probably benign Het
Mgam T C 6: 40,746,488 probably null Het
Mog T C 17: 37,014,756 T196A possibly damaging Het
Ms4a6d T C 19: 11,601,852 Y87C possibly damaging Het
Ndrg4 C T 8: 95,709,184 probably benign Het
Nsd1 T A 13: 55,247,058 M927K possibly damaging Het
Olfr1246 G T 2: 89,591,091 T8K probably damaging Het
Olfr323 T A 11: 58,625,456 M197L probably benign Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Pcdhac2 A G 18: 37,146,042 R692G possibly damaging Het
Pcsk4 T A 10: 80,325,030 S321C probably damaging Het
Pi4ka A G 16: 17,302,995 F1292L Het
Pigv G T 4: 133,669,799 P6Q possibly damaging Het
Pkhd1 A C 1: 20,548,127 S927A probably benign Het
Pnpla3 A T 15: 84,171,162 I90F probably benign Het
Pole C A 5: 110,325,556 L1739I probably damaging Het
Pole T A 5: 110,325,557 L1739H probably damaging Het
Rbm12 A T 2: 156,097,397 N318K possibly damaging Het
Rpl18a A T 8: 70,895,535 L168Q probably benign Het
Ryr2 T C 13: 11,750,968 N1294S probably damaging Het
Sema5b T C 16: 35,632,853 L98P possibly damaging Het
Smg7 A G 1: 152,845,511 V650A probably damaging Het
Strada C T 11: 106,184,618 R13Q probably damaging Het
Sun1 T C 5: 139,215,163 S37P unknown Het
Syce1l T C 8: 113,654,106 probably null Het
Tdg T A 10: 82,644,673 F263L probably damaging Het
Tead3 G T 17: 28,341,521 S36R probably benign Het
Timm44 A G 8: 4,260,621 L377P probably damaging Het
Tk1 C T 11: 117,825,755 V9M probably benign Het
Trim36 A G 18: 46,167,439 Y722H probably benign Het
Ttn A T 2: 76,809,888 M13792K possibly damaging Het
Unc80 A G 1: 66,555,252 probably benign Het
Usp46 G T 5: 74,029,304 A133E probably benign Het
Wnk2 T A 13: 49,067,954 R1240S probably benign Het
Zfp821 G A 8: 109,724,350 R325Q probably damaging Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R7918:Epha8 UTSW 4 136934566 missense probably benign 0.12
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8445:Epha8 UTSW 4 136932289 missense probably benign 0.13
R8889:Epha8 UTSW 4 136934539 missense probably benign 0.45
R8892:Epha8 UTSW 4 136934539 missense probably benign 0.45
R8928:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8965:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8983:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8984:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8988:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9081:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9231:Epha8 UTSW 4 136945915 missense probably damaging 1.00
R9370:Epha8 UTSW 4 136946200 missense possibly damaging 0.94
R9466:Epha8 UTSW 4 136935103 missense probably benign
R9478:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9546:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9547:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9550:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9585:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9624:Epha8 UTSW 4 136931754 missense probably damaging 1.00
R9686:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9687:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9690:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9744:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9763:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R9794:Epha8 UTSW 4 136938724 missense probably benign 0.16
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGTCTCTGCCTTTGCTAAG -3'
(R):5'- TGACCAACCAGGATGTGAGC -3'

Sequencing Primer
(F):5'- CTTTGCTAAGGACGTGGGCAC -3'
(R):5'- TGCAGCTGTGAGTCCTCC -3'
Posted On 2022-03-25