Mutagenetix > Incidental Mutation

Incidental Mutation 'R9262:Epha8'

702302

Institutional Source

Beutler Lab

Gene Symbol

Epha8

Ensembl Gene

ENSMUSG00000028661

Gene Name

Eph receptor A8

Synonyms

EphA8, Hek3, Eek

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9262 (G1)

Quality Score

206.009

Status

Validated

Chromosome

Chromosomal Location

136929419-136956816 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 136931684 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 886 (H886Q)

Ref Sequence

ENSEMBL: ENSMUSP00000030420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030420]

AlphaFold

O09127

Predicted Effect

probably benign
Transcript: ENSMUST00000030420
AA Change: H886Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: H886Q

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
EPH_lbd	30	203	2.59e-116	SMART
FN3	328	418	4.03e-6	SMART
FN3	439	520	1.67e-12	SMART
Pfam:EphA2_TM	542	631	5.8e-10	PFAM
TyrKc	634	891	1.03e-125	SMART
SAM	926	993	4.74e-19	SMART

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,588	M473V	probably benign	Het
4933409G03Rik	A	T	2: 68,613,031	H192L	unknown	Het
Abca4	T	A	3: 122,170,990	C2149S	probably damaging	Het
Abl2	G	A	1: 156,642,250	G1028D	possibly damaging	Het
Adgre1	A	G	17: 57,447,941	T680A	probably damaging	Het
Amn	G	A	12: 111,271,151	W10*	probably null	Het
Ankhd1	G	T	18: 36,632,746	V140F		Het
Asnsd1	A	T	1: 53,344,775	N613K	probably benign	Het
Bbs2	A	T	8: 94,080,915	I417N	probably damaging	Het
Cad	T	A	5: 31,067,665	W971R	probably null	Het
Cand2	A	T	6: 115,782,769	I134F	probably benign	Het
Ccdc154	C	A	17: 25,170,186	H453N	probably damaging	Het
Ccdc7a	T	A	8: 128,759,796	H1601L	possibly damaging	Het
Ccdc9	A	C	7: 16,278,475	S261A	probably benign	Het
Cdkl3	T	A	11: 52,025,875	S277T	probably benign	Het
Cipc	T	A	12: 86,952,723	Y8*	probably null	Het
Cramp1l	A	G	17: 25,013,946	S27P	probably damaging	Het
Csf1r	A	T	18: 61,110,334	M141L	probably benign	Het
Csf2rb2	G	T	15: 78,284,335	F873L	probably damaging	Het
Dchs1	G	A	7: 105,755,626	R2570W	probably damaging	Het
Dmxl1	A	T	18: 49,843,852	N94Y	probably benign	Het
Dnajc10	A	G	2: 80,346,621	K640R	probably benign	Het
Fcgbp	G	C	7: 28,120,527	D2560H	probably damaging	Het
Fry	T	G	5: 150,381,644	F605V	probably damaging	Het
Fsip2	A	G	2: 82,977,318	N1327S	probably benign	Het
Gm12117	T	C	11: 33,276,001	T112A	probably benign	Het
Gm3604	A	T	13: 62,369,883	N220K	probably damaging	Het
Gm572	T	C	4: 148,651,195	V27A	probably benign	Het
Gm6614	G	T	6: 141,980,868	F597L	probably damaging	Het
Gm8251	A	G	1: 44,057,109	S1610P	possibly damaging	Het
Gm853	A	G	4: 130,220,360	V88A	possibly damaging	Het
Gpr39	A	G	1: 125,872,787	K425R	probably benign	Het
Heatr3	A	G	8: 88,156,469	D349G	probably benign	Het
Hip1	A	G	5: 135,449,687	S248P	probably damaging	Het
Itga11	A	G	9: 62,752,396		probably benign	Het
Itga3	C	T	11: 95,065,799	V210I	probably benign	Het
Jmjd1c	T	C	10: 67,248,014	I2173T	probably benign	Het
Klf13	G	A	7: 63,924,708	Q21*	probably null	Het
Kmt2a	A	T	9: 44,819,925	S3032T	probably benign	Het
Krt34	T	C	11: 100,040,025	R184G	probably benign	Het
Krtap16-1	T	C	11: 99,986,168	T137A	probably benign	Het
Mgam	T	C	6: 40,746,488		probably null	Het
Mog	T	C	17: 37,014,756	T196A	possibly damaging	Het
Ms4a6d	T	C	19: 11,601,852	Y87C	possibly damaging	Het
Ndrg4	C	T	8: 95,709,184		probably benign	Het
Nsd1	T	A	13: 55,247,058	M927K	possibly damaging	Het
Olfr1246	G	T	2: 89,591,091	T8K	probably damaging	Het
Olfr323	T	A	11: 58,625,456	M197L	probably benign	Het
Ovgp1	T	C	3: 105,986,567		probably benign	Het
Pcdhac2	A	G	18: 37,146,042	R692G	possibly damaging	Het
Pcsk4	T	A	10: 80,325,030	S321C	probably damaging	Het
Pi4ka	A	G	16: 17,302,995	F1292L		Het
Pigv	G	T	4: 133,669,799	P6Q	possibly damaging	Het
Pkhd1	A	C	1: 20,548,127	S927A	probably benign	Het
Pnpla3	A	T	15: 84,171,162	I90F	probably benign	Het
Pole	C	A	5: 110,325,556	L1739I	probably damaging	Het
Pole	T	A	5: 110,325,557	L1739H	probably damaging	Het
Rbm12	A	T	2: 156,097,397	N318K	possibly damaging	Het
Rpl18a	A	T	8: 70,895,535	L168Q	probably benign	Het
Ryr2	T	C	13: 11,750,968	N1294S	probably damaging	Het
Sema5b	T	C	16: 35,632,853	L98P	possibly damaging	Het
Smg7	A	G	1: 152,845,511	V650A	probably damaging	Het
Strada	C	T	11: 106,184,618	R13Q	probably damaging	Het
Sun1	T	C	5: 139,215,163	S37P	unknown	Het
Syce1l	T	C	8: 113,654,106		probably null	Het
Tdg	T	A	10: 82,644,673	F263L	probably damaging	Het
Tead3	G	T	17: 28,341,521	S36R	probably benign	Het
Timm44	A	G	8: 4,260,621	L377P	probably damaging	Het
Tk1	C	T	11: 117,825,755	V9M	probably benign	Het
Trim36	A	G	18: 46,167,439	Y722H	probably benign	Het
Ttn	A	T	2: 76,809,888	M13792K	possibly damaging	Het
Unc80	A	G	1: 66,555,252		probably benign	Het
Usp46	G	T	5: 74,029,304	A133E	probably benign	Het
Wnk2	T	A	13: 49,067,954	R1240S	probably benign	Het
Zfp821	G	A	8: 109,724,350	R325Q	probably damaging	Het

Other mutations in Epha8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Epha8	APN	4	136945810	missense	probably damaging	1.00
IGL00960:Epha8	APN	4	136951839	splice site	probably null
IGL01124:Epha8	APN	4	136936083	missense	probably damaging	1.00
IGL01550:Epha8	APN	4	136931740	missense	possibly damaging	0.87
IGL01807:Epha8	APN	4	136931682	missense	probably benign	0.08
IGL01844:Epha8	APN	4	136931049	makesense	probably null
IGL02167:Epha8	APN	4	136931094	missense	probably damaging	1.00
R0255:Epha8	UTSW	4	136940286	missense	probably damaging	0.99
R0445:Epha8	UTSW	4	136932400	missense	probably damaging	1.00
R1757:Epha8	UTSW	4	136931478	splice site	probably null
R1911:Epha8	UTSW	4	136936314	missense	probably damaging	1.00
R1936:Epha8	UTSW	4	136940243	missense	probably benign	0.08
R2291:Epha8	UTSW	4	136933347	missense	probably damaging	1.00
R2359:Epha8	UTSW	4	136946032	missense	probably damaging	1.00
R2372:Epha8	UTSW	4	136933010	missense	probably damaging	1.00
R4581:Epha8	UTSW	4	136933464	missense	probably damaging	1.00
R4747:Epha8	UTSW	4	136938695	frame shift	probably null
R4784:Epha8	UTSW	4	136933322	missense	probably damaging	1.00
R5156:Epha8	UTSW	4	136938726	missense	probably benign	0.14
R5164:Epha8	UTSW	4	136945672	missense	possibly damaging	0.93
R5335:Epha8	UTSW	4	136931935	missense	probably damaging	1.00
R5480:Epha8	UTSW	4	136935130	missense	probably benign
R5552:Epha8	UTSW	4	136931899	missense	probably damaging	1.00
R5830:Epha8	UTSW	4	136936390	nonsense	probably null
R6017:Epha8	UTSW	4	136931743	missense	probably damaging	1.00
R6450:Epha8	UTSW	4	136931899	missense	probably damaging	1.00
R6798:Epha8	UTSW	4	136945669	missense	probably benign	0.00
R6799:Epha8	UTSW	4	136945669	missense	probably benign	0.00
R7060:Epha8	UTSW	4	136931158	missense	probably damaging	1.00
R7297:Epha8	UTSW	4	136945913	missense	probably damaging	1.00
R7344:Epha8	UTSW	4	136934538	missense	probably benign	0.14
R7467:Epha8	UTSW	4	136931088	missense	possibly damaging	0.90
R7563:Epha8	UTSW	4	136938789	missense	possibly damaging	0.77
R7826:Epha8	UTSW	4	136936187	missense	probably benign	0.09
R7845:Epha8	UTSW	4	136936401	missense	probably benign	0.04
R7863:Epha8	UTSW	4	136933655	missense	probably damaging	1.00
R7904:Epha8	UTSW	4	136931739	missense	possibly damaging	0.95
R7918:Epha8	UTSW	4	136934566	missense	probably benign	0.12
R8177:Epha8	UTSW	4	136945663	missense	probably benign	0.00
R8244:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8266:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8268:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8269:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8289:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8290:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8294:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8295:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8299:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8445:Epha8	UTSW	4	136932289	missense	probably benign	0.13
R8889:Epha8	UTSW	4	136934539	missense	probably benign	0.45
R8892:Epha8	UTSW	4	136934539	missense	probably benign	0.45
R8928:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8965:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8983:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8984:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8988:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9081:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9231:Epha8	UTSW	4	136945915	missense	probably damaging	1.00
R9370:Epha8	UTSW	4	136946200	missense	possibly damaging	0.94
R9466:Epha8	UTSW	4	136935103	missense	probably benign
R9478:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9546:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9547:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9550:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9585:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9624:Epha8	UTSW	4	136931754	missense	probably damaging	1.00
R9686:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9687:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9690:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9744:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9763:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R9794:Epha8	UTSW	4	136938724	missense	probably benign	0.16
RF025:Epha8	UTSW	4	136933037	critical splice acceptor site	probably benign
RF054:Epha8	UTSW	4	136933037	critical splice acceptor site	probably benign
Z1176:Epha8	UTSW	4	136938696	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGGTCTCTGCCTTTGCTAAG -3'
(R):5'- TGACCAACCAGGATGTGAGC -3'

Sequencing Primer
(F):5'- CTTTGCTAAGGACGTGGGCAC -3'
(R):5'- TGCAGCTGTGAGTCCTCC -3'

Posted On

2022-03-25