Incidental Mutation 'R0014:Rorc'
ID64864
Institutional Source Beutler Lab
Gene Symbol Rorc
Ensembl Gene ENSMUSG00000028150
Gene NameRAR-related orphan receptor gamma
SynonymsThor, thymus orphan receptor, RORgamma
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R0014 (G1)
Quality Score112
Status Validated
Chromosome3
Chromosomal Location94372794-94398276 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 94377613 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029795] [ENSMUST00000197040] [ENSMUST00000200009]
Predicted Effect probably benign
Transcript: ENSMUST00000029795
SMART Domains Protein: ENSMUSP00000029795
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 28 99 7.2e-37 SMART
low complexity region 116 133 N/A INTRINSIC
HOLI 320 474 3.78e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107292
SMART Domains Protein: ENSMUSP00000102913
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197040
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198793
Predicted Effect probably benign
Transcript: ENSMUST00000200009
SMART Domains Protein: ENSMUSP00000143610
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 13 84 7.2e-37 SMART
low complexity region 101 118 N/A INTRINSIC
PDB:3L0L|B 243 309 1e-22 PDB
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of peripheral and mesenteric lymph nodes and Peyer's patches, reduced numbers of thymocytes, and increased apoptosis with loss of thymic expression of anti-apoptosic factor Bcl-xL. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Rorc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Rorc APN 3 94388787 missense probably damaging 1.00
beto UTSW 3 94377608 splice site probably null
cashew UTSW 3 94391153 missense probably damaging 1.00
chestnut UTSW 3 94377609 splice site probably benign
macadamias UTSW 3 94397302 nonsense probably null
macadamias2 UTSW 3 94387193 missense probably damaging 1.00
R0115:Rorc UTSW 3 94377609 splice site probably benign
R0365:Rorc UTSW 3 94388762 missense probably damaging 1.00
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1470:Rorc UTSW 3 94397302 nonsense probably null
R1914:Rorc UTSW 3 94391173 missense probably damaging 1.00
R1915:Rorc UTSW 3 94391173 missense probably damaging 1.00
R2142:Rorc UTSW 3 94389526 missense probably benign 0.04
R2510:Rorc UTSW 3 94389120 missense probably benign 0.30
R4135:Rorc UTSW 3 94389519 missense probably damaging 1.00
R4181:Rorc UTSW 3 94387193 missense probably damaging 1.00
R4574:Rorc UTSW 3 94388984 missense probably benign 0.00
R4701:Rorc UTSW 3 94391710 missense probably null 1.00
R5014:Rorc UTSW 3 94391153 missense probably damaging 1.00
R5233:Rorc UTSW 3 94397325 missense probably benign 0.26
R6758:Rorc UTSW 3 94387518 missense possibly damaging 0.90
R7069:Rorc UTSW 3 94372907 nonsense probably null
R7162:Rorc UTSW 3 94377608 splice site probably null
R7169:Rorc UTSW 3 94389180 missense probably benign 0.00
X0063:Rorc UTSW 3 94391751 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCCTGTCATCATACCCAATGCAC -3'
(R):5'- ACCATTGCTGCCAAGGAAGCTG -3'

Sequencing Primer
(F):5'- TGTGGAGCAGAGCTTAAACCC -3'
(R):5'- CCAAGGAAGCTGCCAGG -3'
Posted On2013-08-06