Incidental Mutation 'R7972:Foxd4'
ID650687
Institutional Source Beutler Lab
Gene Symbol Foxd4
Ensembl Gene ENSMUSG00000051490
Gene Nameforkhead box D4
SynonymsFkh2, FREAC5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7972 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location24898965-24901309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24900230 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 202 (H202R)
Ref Sequence ENSEMBL: ENSMUSP00000058575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058600]
Predicted Effect probably damaging
Transcript: ENSMUST00000058600
AA Change: H202R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058575
Gene: ENSMUSG00000051490
AA Change: H202R

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 86 96 N/A INTRINSIC
FH 101 191 5.83e-57 SMART
low complexity region 243 257 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
low complexity region 377 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead/winged helix-box (FOX) family of transcription factors. FOX transcription factors play critical roles in the regulation of multiple processes including metabolism, cell proliferation and gene expression during ontogenesis. Mutations in this gene are associated with a complex phenotype consisting of dilated cardiomyopathy, obsessive-compulsive disorders, and suicidality. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T A 17: 35,101,311 V384E probably damaging Het
Acacb C T 5: 114,226,857 R1533* probably null Het
Alox12 T A 11: 70,242,687 M604L probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Brdt A T 5: 107,348,549 I176F possibly damaging Het
Cdk5 G T 5: 24,419,658 T245K probably benign Het
Chd9 A T 8: 91,005,767 R1304S unknown Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cyp2j11 T A 4: 96,297,634 E438V probably damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dnah10 T C 5: 124,726,885 V92A probably benign Het
Dusp27 T A 1: 166,099,139 E968V probably damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam184a A T 10: 53,638,259 L1022Q probably damaging Het
Fry T C 5: 150,310,396 V16A probably benign Het
Gstcd A T 3: 133,072,133 F306I probably benign Het
Hist1h2bl A G 13: 21,715,807 S113P possibly damaging Het
Hivep3 T C 4: 120,097,514 V1009A possibly damaging Het
Hoxd12 G T 2: 74,675,925 R227L probably damaging Het
Ifi208 T A 1: 173,678,990 M113K possibly damaging Het
Kcnh4 T G 11: 100,752,452 T330P probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lin28a G A 4: 134,006,263 P158S probably damaging Het
Muc16 C A 9: 18,645,764 E3078* probably null Het
Naaladl1 A G 19: 6,106,244 N120S probably damaging Het
Nol10 G A 12: 17,352,647 R40H probably benign Het
Ntng1 G A 3: 110,135,486 S8L probably benign Het
Olfr1212 T A 2: 88,958,833 Y122* probably null Het
Olfr1243 T G 2: 89,527,604 I269L probably benign Het
Pacsin1 T A 17: 27,708,639 F319I unknown Het
Pla2g4d G A 2: 120,278,932 T212I probably benign Het
Ppp4r1 T A 17: 65,833,098 C664S possibly damaging Het
Prodh2 T C 7: 30,511,155 I377T probably damaging Het
Prss57 A T 10: 79,783,396 L243H probably benign Het
Pxdn C T 12: 30,006,602 L1271F probably damaging Het
Ros1 G A 10: 52,154,830 R581* probably null Het
Rps6kc1 C T 1: 190,799,124 G894S probably benign Het
Sirt7 A G 11: 120,619,190 S183P unknown Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d8 A G 1: 39,392,169 F374S probably damaging Het
Tdrd1 T A 19: 56,848,702 D489E probably damaging Het
Tiprl T A 1: 165,236,974 probably benign Het
Tpt1 T C 14: 75,848,099 *173Q probably null Het
Trim17 A G 11: 58,968,568 I203V probably benign Het
Trim43b T A 9: 89,091,308 H124L probably damaging Het
Triobp T C 15: 78,967,986 I780T probably damaging Het
Ttc30a1 A T 2: 75,980,458 M427K probably damaging Het
Tyrobp G A 7: 30,414,638 G101R Het
Vmn1r181 A T 7: 23,984,446 H112L probably benign Het
Wdr19 A G 5: 65,223,850 N406D probably damaging Het
Zc3h12a T C 4: 125,119,935 K379E probably benign Het
Zcwpw1 T C 5: 137,801,061 I230T probably benign Het
Zfhx4 A G 3: 5,412,473 T3383A probably benign Het
Other mutations in Foxd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02527:Foxd4 APN 19 24899814 missense probably benign
IGL02709:Foxd4 APN 19 24899609 missense probably damaging 0.98
R0544:Foxd4 UTSW 19 24899818 missense possibly damaging 0.95
R1969:Foxd4 UTSW 19 24899814 missense probably benign
R2187:Foxd4 UTSW 19 24899855 missense probably damaging 0.98
R4698:Foxd4 UTSW 19 24900261 missense probably damaging 1.00
R5521:Foxd4 UTSW 19 24899643 missense probably damaging 0.99
R6260:Foxd4 UTSW 19 24899604 missense probably benign 0.02
R6327:Foxd4 UTSW 19 24900834 start codon destroyed possibly damaging 0.89
R6943:Foxd4 UTSW 19 24899876 missense probably damaging 1.00
R7417:Foxd4 UTSW 19 24900462 missense probably damaging 1.00
R8752:Foxd4 UTSW 19 24900730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGGGTTGTCGCCATAGG -3'
(R):5'- TCATCACCATGGCCATCCTG -3'

Sequencing Primer
(F):5'- CAGGTAGCGCATGGGATG -3'
(R):5'- GGTATCTGCGCCTTCATCAG -3'
Posted On2020-09-15