Incidental Mutation 'R7992:Ptger4'
ID651833
Institutional Source Beutler Lab
Gene Symbol Ptger4
Ensembl Gene ENSMUSG00000039942
Gene Nameprostaglandin E receptor 4 (subtype EP4)
SynonymsEP4, Ptgerep4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R7992 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location5206661-5244187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5234900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 425 (Y425C)
Ref Sequence ENSEMBL: ENSMUSP00000048736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047379] [ENSMUST00000120563]
Predicted Effect probably damaging
Transcript: ENSMUST00000047379
AA Change: Y425C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048736
Gene: ENSMUSG00000039942
AA Change: Y425C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 258 1.3e-7 PFAM
Pfam:7tm_1 59 357 1.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120563
AA Change: Y400C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112858
Gene: ENSMUSG00000039942
AA Change: Y400C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 25 233 1.9e-7 PFAM
Pfam:7tm_1 34 332 8.5e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T-cell factor signaling. It has been shown to mediate PGE2 induced expression of early growth response 1 (EGR1), regulate the level and stability of cyclooxygenase-2 mRNA, and lead to the phosphorylation of glycogen synthase kinase-3. Knockout studies in mice suggest that this receptor may be involved in the neonatal adaptation of circulatory system, osteoporosis, as well as initiation of skin immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous targeted null mutants die shortly after birth due to failed closure of the ductus arteriosis. Survivors show decreased migration of Langerhans cells to lymph nodes, contact hypersensitivity and decreased incidence of induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Ptger4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Ptger4 APN 15 5243133 missense probably benign 0.00
IGL00848:Ptger4 APN 15 5235108 missense probably benign 0.16
IGL01309:Ptger4 APN 15 5242758 missense probably damaging 1.00
IGL02083:Ptger4 APN 15 5243174 missense probably benign 0.00
IGL03245:Ptger4 APN 15 5235107 missense probably damaging 1.00
R0369:Ptger4 UTSW 15 5243010 missense probably benign 0.06
R0427:Ptger4 UTSW 15 5242901 missense probably benign 0.25
R1399:Ptger4 UTSW 15 5234931 missense possibly damaging 0.81
R1778:Ptger4 UTSW 15 5235095 missense probably damaging 1.00
R1801:Ptger4 UTSW 15 5242800 missense possibly damaging 0.95
R2089:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2484:Ptger4 UTSW 15 5235173 missense probably benign 0.06
R2873:Ptger4 UTSW 15 5234805 missense probably benign 0.02
R4515:Ptger4 UTSW 15 5242379 missense probably damaging 1.00
R4572:Ptger4 UTSW 15 5243133 missense probably benign 0.00
R4655:Ptger4 UTSW 15 5243064 missense probably benign 0.06
R4860:Ptger4 UTSW 15 5242606 missense probably benign 0.02
R4860:Ptger4 UTSW 15 5242606 missense probably benign 0.02
R6429:Ptger4 UTSW 15 5242997 missense possibly damaging 0.76
R6960:Ptger4 UTSW 15 5234715 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCTTTAGAGGCAGGCTCC -3'
(R):5'- TTCGGAAGACTGTGCTCAG -3'

Sequencing Primer
(F):5'- AGGCAGGCTCCTCTCTGTG -3'
(R):5'- CTGTGCTCAGTAAAGCCATAGAG -3'
Posted On2020-09-15