Mutagenetix > Incidental Mutations

Incidental Mutation 'R0390:Rtl1'

65415

Institutional Source

Beutler Lab

Gene Symbol

Rtl1

Ensembl Gene

ENSMUSG00000085925

Gene Name

retrotransposon Gaglike 1

Synonyms

Mart1, Mor1, Mar

MMRRC Submission

038596-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0390 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

109589193-109600330 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 109591386 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1340 (E1340K)

Ref Sequence

ENSEMBL: ENSMUSP00000115957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000149046]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093564

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093572

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093621

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093625

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000102358

Predicted Effect

unknown
Transcript: ENSMUST00000149046
AA Change: E1340K

SMART Domains

Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: E1340K

Domain	Start	End	E-Value	Type
low complexity region	19	30	N/A	INTRINSIC
low complexity region	41	80	N/A	INTRINSIC
internal_repeat_1	88	163	8.8e-50	PROSPERO
internal_repeat_1	176	251	8.8e-50	PROSPERO
low complexity region	332	361	N/A	INTRINSIC
low complexity region	380	391	N/A	INTRINSIC
low complexity region	393	408	N/A	INTRINSIC
Pfam:DUF4939	432	538	1.6e-14	PFAM
Pfam:Retrotrans_gag	493	586	9.2e-13	PFAM
low complexity region	611	632	N/A	INTRINSIC
Pfam:gag-asp_proteas	663	731	2.3e-15	PFAM
low complexity region	833	849	N/A	INTRINSIC
low complexity region	878	892	N/A	INTRINSIC
PDB:4OL8\|E	988	1192	6e-17	PDB
Blast:CYCc	989	1158	5e-9	BLAST
SCOP:d1sig__	1291	1443	2e-4	SMART
low complexity region	1733	1744	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175468

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199494

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.9%
20x: 92.0%

Validation Efficiency

98% (110/112)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730017C20Rik	T	A	18: 59,075,688	V136E	probably damaging	Het
Adam18	C	T	8: 24,674,054	G38R	probably benign	Het
Ap2m1	T	C	16: 20,541,099	M183T	probably damaging	Het
Apob	A	T	12: 7,988,678	I364F	probably damaging	Het
Arl6	A	T	16: 59,622,421		probably benign	Het
Cand2	A	G	6: 115,774,653	M15V	possibly damaging	Het
Cbl	A	G	9: 44,201,005	F131S	probably damaging	Het
Ccdc151	T	A	9: 21,991,708	H442L	probably benign	Het
Ccdc74a	A	G	16: 17,650,476	S321G	probably benign	Het
Cdc14b	T	C	13: 64,210,192		probably benign	Het
Cep152	T	C	2: 125,576,869		probably benign	Het
Cep290	A	G	10: 100,508,758	E479G	probably benign	Het
Chrm2	T	G	6: 36,524,111	I301R	probably benign	Het
Clec2e	A	G	6: 129,093,468	W197R	probably damaging	Het
Cnot10	G	T	9: 114,629,150	S96*	probably null	Het
Col19a1	A	G	1: 24,289,655		probably benign	Het
Csmd2	T	C	4: 128,133,673		probably benign	Het
Cthrc1	A	T	15: 39,086,764	*172L	probably null	Het
Cul9	A	T	17: 46,528,589	I821N	probably benign	Het
Daam1	G	C	12: 71,975,304		probably benign	Het
Dhx58	A	T	11: 100,699,264	I398N	probably damaging	Het
Dip2b	T	A	15: 100,193,913	H844Q	probably damaging	Het
Dmac2	A	G	7: 25,621,029	D50G	probably damaging	Het
Dmxl1	C	A	18: 49,879,362	Q1529K	probably benign	Het
Dtna	C	T	18: 23,597,501	P315L	probably damaging	Het
Ep300	T	C	15: 81,640,116	S1382P	unknown	Het
Fat2	A	T	11: 55,310,777	N490K	probably damaging	Het
Flg2	T	A	3: 93,200,355		probably benign	Het
Gm13084	T	A	4: 143,811,699	D234V	probably benign	Het
Gpatch1	T	C	7: 35,281,381		probably benign	Het
Grin2a	C	A	16: 9,579,585	K879N	possibly damaging	Het
Hacd3	A	C	9: 65,001,022	I164S	possibly damaging	Het
Hinfp	A	C	9: 44,298,948	C197G	probably damaging	Het
Hsd17b12	T	C	2: 94,114,990		probably benign	Het
Hsd3b1	A	T	3: 98,853,039	L212Q	probably damaging	Het
Ifrd1	C	T	12: 40,214,094		probably null	Het
Igf2bp2	A	G	16: 22,081,801	F129L	possibly damaging	Het
Kirrel3	T	A	9: 35,020,163	I409N	probably damaging	Het
Klhdc10	T	C	6: 30,447,412	I204T	probably damaging	Het
Kpna6	A	T	4: 129,657,804	S65R	possibly damaging	Het
Lama3	A	T	18: 12,407,563	D308V	probably benign	Het
Larp4b	T	A	13: 9,158,107		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lyzl1	A	T	18: 4,169,175	T11S	probably benign	Het
Man1c1	A	G	4: 134,578,315	L366P	probably damaging	Het
Mef2a	A	G	7: 67,251,724	M100T	probably damaging	Het
Mettl13	G	A	1: 162,538,889	H474Y	possibly damaging	Het
Mmp3	A	G	9: 7,451,320	D352G	probably benign	Het
Mns1	T	C	9: 72,452,804	I412T	probably damaging	Het
Mon2	T	C	10: 123,007,021	D1501G	probably null	Het
Mylk	G	T	16: 34,875,620	G242W	probably damaging	Het
Nav1	T	C	1: 135,449,966	D1715G	possibly damaging	Het
Nckap1l	T	C	15: 103,453,883	S2P	probably damaging	Het
Nek3	A	T	8: 22,128,729		probably benign	Het
Nfrkb	A	G	9: 31,388,897		probably benign	Het
Nlrp4d	T	C	7: 10,388,778	D53G	probably benign	Het
Nol8	T	C	13: 49,662,152	S561P	probably damaging	Het
Nuf2	A	C	1: 169,525,297		probably benign	Het
Ofcc1	T	A	13: 40,015,313	D866V	possibly damaging	Het
Olfr195	A	G	16: 59,149,299	I150V	probably benign	Het
Optn	A	G	2: 5,046,195	L125P	probably benign	Het
Otoa	T	A	7: 121,131,341	F588Y	probably benign	Het
Pappa	T	A	4: 65,351,613		probably null	Het
Pde5a	T	G	3: 122,835,583	C635W	probably damaging	Het
Pdgfb	A	T	15: 80,003,419		probably null	Het
Pih1d2	T	A	9: 50,621,046	C135S	probably damaging	Het
Plcg1	G	T	2: 160,752,366	C361F	probably damaging	Het
Ppp4r4	T	C	12: 103,601,360		probably benign	Het
Prdm10	G	A	9: 31,349,268		probably null	Het
Prex2	T	A	1: 11,089,706		probably null	Het
Prss56	T	G	1: 87,184,730		probably null	Het
Prtg	A	G	9: 72,844,958	K209E	probably benign	Het
Ptprc	G	A	1: 138,122,575	T36I	possibly damaging	Het
Rasgrp4	A	G	7: 29,145,860	Y302C	probably damaging	Het
Rb1cc1	T	A	1: 6,248,634	M759K	probably damaging	Het
Rbm15b	T	A	9: 106,885,998	M324L	probably benign	Het
Rcbtb2	T	C	14: 73,178,547	V500A	probably damaging	Het
Rgs6	A	G	12: 83,133,677	K434R	probably damaging	Het
Rims1	C	T	1: 22,596,526	A125T	possibly damaging	Het
Robo3	A	G	9: 37,422,177	V746A	probably benign	Het
Sacs	G	A	14: 61,205,640	D1712N	possibly damaging	Het
Samd4b	G	A	7: 28,403,977	P19S	probably benign	Het
Samhd1	T	C	2: 157,114,231	Y347C	probably damaging	Het
Sema6d	T	A	2: 124,658,490	I393N	probably damaging	Het
Sigmar1	C	T	4: 41,741,243	A4T	probably benign	Het
Skint9	C	A	4: 112,389,179	L245F	probably benign	Het
Slc35f5	T	C	1: 125,585,095	L372P	probably damaging	Het
Smc1b	A	T	15: 85,066,277	I1182N	probably damaging	Het
Smyd3	A	G	1: 178,957,573		probably benign	Het
Sptlc1	T	C	13: 53,337,612	D417G	probably benign	Het
Sv2c	T	C	13: 96,088,708	N31S	probably benign	Het
Tjp1	T	C	7: 65,314,990	D811G	probably damaging	Het
Top2b	A	G	14: 16,418,442	T1221A	probably benign	Het
Tph2	T	C	10: 115,174,109	D182G	probably damaging	Het
Traf6	C	T	2: 101,688,588	Q141*	probably null	Het
Ttn	T	C	2: 76,756,931	D21574G	probably damaging	Het
Uba2	T	A	7: 34,151,021	N367I	probably benign	Het
Ube2b	T	C	11: 51,988,602		probably benign	Het
Ubr5	G	T	15: 38,030,672	L426I	probably benign	Het
Ugt2a2	T	A	5: 87,464,148	H301L	probably benign	Het
Upf2	T	A	2: 6,018,894		probably benign	Het
Utrn	T	C	10: 12,710,060	D991G	probably benign	Het
Vmn2r25	T	C	6: 123,823,181	D734G	probably damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Vwf	T	A	6: 125,626,361	Y891*	probably null	Het
Wwox	C	T	8: 114,706,278	T228I	probably benign	Het
Zer1	C	T	2: 30,108,213		probably benign	Het
Zfp180	C	T	7: 24,104,707	H184Y	possibly damaging	Het
Zfp68	A	T	5: 138,607,225	Y279N	probably benign	Het

Other mutations in Rtl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Rtl1	APN	12	109593000	missense	probably benign	0.00
IGL01981:Rtl1	APN	12	109591935	missense	possibly damaging	0.72
IGL02418:Rtl1	APN	12	109590449	missense	probably damaging	1.00
IGL03164:Rtl1	APN	12	109592933	missense	probably damaging	1.00
FR4304:Rtl1	UTSW	12	109591198	small deletion	probably benign
R0109:Rtl1	UTSW	12	109595407	start gained	probably benign
R0141:Rtl1	UTSW	12	109592948	missense	probably damaging	1.00
R0312:Rtl1	UTSW	12	109590227	missense	probably damaging	0.99
R0389:Rtl1	UTSW	12	109590363	missense	possibly damaging	0.77
R0548:Rtl1	UTSW	12	109591655	missense	probably damaging	0.98
R0561:Rtl1	UTSW	12	109593929	missense	probably damaging	0.99
R0624:Rtl1	UTSW	12	109592719	missense	probably damaging	0.97
R0746:Rtl1	UTSW	12	109592960	missense	probably damaging	1.00
R1353:Rtl1	UTSW	12	109592199	missense	probably benign	0.00
R1868:Rtl1	UTSW	12	109590536	missense	probably damaging	1.00
R1935:Rtl1	UTSW	12	109591920	missense	probably benign	0.42
R2000:Rtl1	UTSW	12	109593887	missense	probably damaging	1.00
R2094:Rtl1	UTSW	12	109591397	missense	unknown
R2125:Rtl1	UTSW	12	109593921	missense	possibly damaging	0.64
R2166:Rtl1	UTSW	12	109590554	missense	probably damaging	1.00
R2247:Rtl1	UTSW	12	109594979	missense	possibly damaging	0.77
R2274:Rtl1	UTSW	12	109594667	missense	unknown
R2919:Rtl1	UTSW	12	109591148	missense	unknown
R2998:Rtl1	UTSW	12	109595096	missense	probably damaging	0.99
R4554:Rtl1	UTSW	12	109594328	missense	possibly damaging	0.53
R4566:Rtl1	UTSW	12	109592859	missense	probably damaging	1.00
R4887:Rtl1	UTSW	12	109591704	missense	probably damaging	0.96
R5399:Rtl1	UTSW	12	109590302	missense	probably damaging	1.00
R5512:Rtl1	UTSW	12	109591371	missense	unknown
R5616:Rtl1	UTSW	12	109592739	missense	unknown
R5644:Rtl1	UTSW	12	109591579	missense	probably benign	0.03
R5647:Rtl1	UTSW	12	109594679	missense	unknown
R5695:Rtl1	UTSW	12	109594097	missense	probably damaging	1.00
R5714:Rtl1	UTSW	12	109593680	missense	probably damaging	0.99
R5786:Rtl1	UTSW	12	109592619	missense	possibly damaging	0.89
R5917:Rtl1	UTSW	12	109591653	missense	possibly damaging	0.82
R5948:Rtl1	UTSW	12	109590599	missense	possibly damaging	0.86
R6051:Rtl1	UTSW	12	109593024	missense	probably damaging	1.00
R6251:Rtl1	UTSW	12	109593649	missense	probably benign	0.16
R6342:Rtl1	UTSW	12	109592301	missense	possibly damaging	0.50
R6433:Rtl1	UTSW	12	109595196	missense	unknown
R6815:Rtl1	UTSW	12	109594503	missense	probably damaging	0.98
R6968:Rtl1	UTSW	12	109594679	missense	unknown
R7002:Rtl1	UTSW	12	109593947	missense	probably damaging	0.97
R7020:Rtl1	UTSW	12	109592315	missense	possibly damaging	0.72
R7026:Rtl1	UTSW	12	109593161	missense	probably damaging	0.99
R7027:Rtl1	UTSW	12	109591414	small deletion	probably benign
R7196:Rtl1	UTSW	12	109592787	missense	possibly damaging	0.83
R7239:Rtl1	UTSW	12	109592475	missense	probably benign	0.05
R7312:Rtl1	UTSW	12	109595238	missense	unknown
R7476:Rtl1	UTSW	12	109591105	missense	unknown
R7589:Rtl1	UTSW	12	109593845	missense	possibly damaging	0.91
R7655:Rtl1	UTSW	12	109591008	missense	unknown
R7656:Rtl1	UTSW	12	109591008	missense	unknown
R7657:Rtl1	UTSW	12	109595384	missense	possibly damaging	0.94
R7720:Rtl1	UTSW	12	109594430	missense	possibly damaging	0.96
R7772:Rtl1	UTSW	12	109593185	missense	probably damaging	1.00
R7840:Rtl1	UTSW	12	109594155	missense	probably benign	0.08
R7890:Rtl1	UTSW	12	109592817	missense	possibly damaging	0.57
R7893:Rtl1	UTSW	12	109593921	missense	possibly damaging	0.64
R7894:Rtl1	UTSW	12	109594597	missense	possibly damaging	0.70
R7909:Rtl1	UTSW	12	109590177	missense	unknown
R7909:Rtl1	UTSW	12	109592480	missense	possibly damaging	0.95
R7923:Rtl1	UTSW	12	109594155	missense	probably benign	0.08
R7973:Rtl1	UTSW	12	109592817	missense	possibly damaging	0.57
R7976:Rtl1	UTSW	12	109593921	missense	possibly damaging	0.64
R7977:Rtl1	UTSW	12	109594597	missense	possibly damaging	0.70
R7990:Rtl1	UTSW	12	109590177	missense	unknown
R7990:Rtl1	UTSW	12	109592480	missense	possibly damaging	0.95
Z1088:Rtl1	UTSW	12	109592319	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGAAGTGAGCCAGTAAGCCATTGAG -3'
(R):5'- GCCCACTGCTGCTTATGTCCATTAG -3'

Sequencing Primer
(F):5'- tcttcctcctcctcttcttcc -3'
(R):5'- CTGCTTATGTCCATTAGGGCAAATC -3'

Posted On

2013-08-08