Incidental Mutation 'R6433:Rtl1'
ID518656
Institutional Source Beutler Lab
Gene Symbol Rtl1
Ensembl Gene ENSMUSG00000085925
Gene Nameretrotransposon Gaglike 1
SynonymsMart1, Mor1, Mar
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location109589193-109600330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109595196 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 70 (A70S)
Ref Sequence ENSEMBL: ENSMUSP00000115957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149046]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093625
Predicted Effect unknown
Transcript: ENSMUST00000149046
AA Change: A70S
SMART Domains Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: A70S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 41 80 N/A INTRINSIC
internal_repeat_1 88 163 8.8e-50 PROSPERO
internal_repeat_1 176 251 8.8e-50 PROSPERO
low complexity region 332 361 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 393 408 N/A INTRINSIC
Pfam:DUF4939 432 538 1.6e-14 PFAM
Pfam:Retrotrans_gag 493 586 9.2e-13 PFAM
low complexity region 611 632 N/A INTRINSIC
Pfam:gag-asp_proteas 663 731 2.3e-15 PFAM
low complexity region 833 849 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
PDB:4OL8|E 988 1192 6e-17 PDB
Blast:CYCc 989 1158 5e-9 BLAST
SCOP:d1sig__ 1291 1443 2e-4 SMART
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199494
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Rtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rtl1 APN 12 109593000 missense probably benign 0.00
IGL01981:Rtl1 APN 12 109591935 missense possibly damaging 0.72
IGL02418:Rtl1 APN 12 109590449 missense probably damaging 1.00
IGL03164:Rtl1 APN 12 109592933 missense probably damaging 1.00
FR4304:Rtl1 UTSW 12 109591198 small deletion probably benign
R0109:Rtl1 UTSW 12 109595407 start gained probably benign
R0141:Rtl1 UTSW 12 109592948 missense probably damaging 1.00
R0312:Rtl1 UTSW 12 109590227 missense probably damaging 0.99
R0389:Rtl1 UTSW 12 109590363 missense possibly damaging 0.77
R0390:Rtl1 UTSW 12 109591386 missense unknown
R0548:Rtl1 UTSW 12 109591655 missense probably damaging 0.98
R0561:Rtl1 UTSW 12 109593929 missense probably damaging 0.99
R0624:Rtl1 UTSW 12 109592719 missense probably damaging 0.97
R0746:Rtl1 UTSW 12 109592960 missense probably damaging 1.00
R1353:Rtl1 UTSW 12 109592199 missense probably benign 0.00
R1868:Rtl1 UTSW 12 109590536 missense probably damaging 1.00
R1935:Rtl1 UTSW 12 109591920 missense probably benign 0.42
R2000:Rtl1 UTSW 12 109593887 missense probably damaging 1.00
R2094:Rtl1 UTSW 12 109591397 missense unknown
R2125:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R2166:Rtl1 UTSW 12 109590554 missense probably damaging 1.00
R2247:Rtl1 UTSW 12 109594979 missense possibly damaging 0.77
R2274:Rtl1 UTSW 12 109594667 missense unknown
R2919:Rtl1 UTSW 12 109591148 missense unknown
R2998:Rtl1 UTSW 12 109595096 missense probably damaging 0.99
R4554:Rtl1 UTSW 12 109594328 missense possibly damaging 0.53
R4566:Rtl1 UTSW 12 109592859 missense probably damaging 1.00
R4887:Rtl1 UTSW 12 109591704 missense probably damaging 0.96
R5399:Rtl1 UTSW 12 109590302 missense probably damaging 1.00
R5512:Rtl1 UTSW 12 109591371 missense unknown
R5616:Rtl1 UTSW 12 109592739 missense unknown
R5644:Rtl1 UTSW 12 109591579 missense probably benign 0.03
R5647:Rtl1 UTSW 12 109594679 missense unknown
R5695:Rtl1 UTSW 12 109594097 missense probably damaging 1.00
R5714:Rtl1 UTSW 12 109593680 missense probably damaging 0.99
R5786:Rtl1 UTSW 12 109592619 missense possibly damaging 0.89
R5917:Rtl1 UTSW 12 109591653 missense possibly damaging 0.82
R5948:Rtl1 UTSW 12 109590599 missense possibly damaging 0.86
R6051:Rtl1 UTSW 12 109593024 missense probably damaging 1.00
R6251:Rtl1 UTSW 12 109593649 missense probably benign 0.16
R6342:Rtl1 UTSW 12 109592301 missense possibly damaging 0.50
R6815:Rtl1 UTSW 12 109594503 missense probably damaging 0.98
R6968:Rtl1 UTSW 12 109594679 missense unknown
R7002:Rtl1 UTSW 12 109593947 missense probably damaging 0.97
R7020:Rtl1 UTSW 12 109592315 missense possibly damaging 0.72
R7026:Rtl1 UTSW 12 109593161 missense probably damaging 0.99
R7027:Rtl1 UTSW 12 109591414 small deletion probably benign
R7196:Rtl1 UTSW 12 109592787 missense possibly damaging 0.83
R7239:Rtl1 UTSW 12 109592475 missense probably benign 0.05
R7312:Rtl1 UTSW 12 109595238 missense unknown
R7476:Rtl1 UTSW 12 109591105 missense unknown
R7589:Rtl1 UTSW 12 109593845 missense possibly damaging 0.91
R7655:Rtl1 UTSW 12 109591008 missense unknown
R7656:Rtl1 UTSW 12 109591008 missense unknown
R7657:Rtl1 UTSW 12 109595384 missense possibly damaging 0.94
R7720:Rtl1 UTSW 12 109594430 missense possibly damaging 0.96
R7772:Rtl1 UTSW 12 109593185 missense probably damaging 1.00
R7840:Rtl1 UTSW 12 109594155 missense probably benign 0.08
R7890:Rtl1 UTSW 12 109592817 missense possibly damaging 0.57
R7893:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R7894:Rtl1 UTSW 12 109594597 missense possibly damaging 0.70
R7909:Rtl1 UTSW 12 109590177 missense unknown
R7909:Rtl1 UTSW 12 109592480 missense possibly damaging 0.95
R7923:Rtl1 UTSW 12 109594155 missense probably benign 0.08
R7973:Rtl1 UTSW 12 109592817 missense possibly damaging 0.57
R7976:Rtl1 UTSW 12 109593921 missense possibly damaging 0.64
R7977:Rtl1 UTSW 12 109594597 missense possibly damaging 0.70
R7990:Rtl1 UTSW 12 109590177 missense unknown
R7990:Rtl1 UTSW 12 109592480 missense possibly damaging 0.95
R8007:Rtl1 UTSW 12 109591626 missense possibly damaging 0.86
R8146:Rtl1 UTSW 12 109590711 missense probably benign 0.01
Z1088:Rtl1 UTSW 12 109592319 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGATCAGTGGGCAGCTCTTG -3'
(R):5'- TTCCAACCGACGACATGATAG -3'

Sequencing Primer
(F):5'- CAGCTCTTGCATTTCCTGGTGG -3'
(R):5'- CCTCTGAAGACTCATTTGAGACG -3'
Posted On2018-05-24