Incidental Mutation 'R8444:Abca3'
ID654414
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene NameATP-binding cassette, sub-family A (ABC1), member 3
SynonymsABC-C, 1810036E22Rik, Abc3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8444 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24351950-24410201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24383985 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 518 (Y518C)
Ref Sequence ENSEMBL: ENSMUSP00000045285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
Predicted Effect probably damaging
Transcript: ENSMUST00000039013
AA Change: Y518C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: Y518C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079594
AA Change: Y518C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: Y518C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117337
AA Change: Y518C
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: Y518C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik G T 11: 70,236,929 R56S possibly damaging Het
1700013F07Rik A G 3: 108,544,068 H115R probably benign Het
Abca14 T A 7: 120,318,910 I1545K probably damaging Het
Abcd2 A G 15: 91,174,636 V535A probably benign Het
Adcy9 T C 16: 4,288,623 T1113A probably damaging Het
Afdn A T 17: 13,883,800 N1133Y probably benign Het
Aip T A 19: 4,116,034 D139V probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 G A 7: 45,149,691 P56S probably benign Het
Alpk3 A C 7: 81,057,720 T31P probably benign Het
Aoc3 G T 11: 101,341,747 R466S unknown Het
Atoh1 T C 6: 64,729,657 L112P probably benign Het
Atp2b2 T A 6: 113,793,811 N424I probably benign Het
Brms1 T C 19: 5,041,492 probably null Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd34 T A 1: 194,958,500 S224R probably benign Het
Cdh20 T A 1: 104,970,858 F437I probably benign Het
Cdkal1 A T 13: 29,326,104 V557E probably benign Het
Chst5 T C 8: 111,890,763 H75R probably damaging Het
Col5a2 A T 1: 45,396,145 N713K probably benign Het
Cpne5 A T 17: 29,188,383 M181K probably benign Het
Cpt1a T C 19: 3,381,981 F731S probably benign Het
Cyfip1 A G 7: 55,872,154 M69V possibly damaging Het
Dennd3 A G 15: 73,570,823 K1232E probably benign Het
Dennd4b A T 3: 90,273,952 H805L probably benign Het
Dnm1l C T 16: 16,341,042 R108Q probably damaging Het
Dsc1 T A 18: 20,089,579 D612V probably benign Het
Ephb2 C T 4: 136,661,400 G628R probably damaging Het
Esrrb G A 12: 86,505,821 R195H probably benign Het
Flg2 A T 3: 93,200,278 E23D probably damaging Het
Gja8 A G 3: 96,919,674 L224P probably damaging Het
Hps6 T G 19: 46,005,428 S601R possibly damaging Het
Ice1 T C 13: 70,604,376 E1197G probably damaging Het
Ifnar2 C A 16: 91,403,969 A366D possibly damaging Het
Ighm A C 12: 113,421,193 S347A Het
Immt C T 6: 71,871,508 R494* probably null Het
Irs2 A G 8: 11,006,683 V583A probably damaging Het
Kcnk4 T C 19: 6,926,140 E347G probably damaging Het
Kif5b T A 18: 6,213,245 I716F probably benign Het
Klhl1 T A 14: 96,517,890 D143V probably benign Het
Lrp1b T C 2: 40,870,260 T2999A Het
Map3k9 A G 12: 81,722,196 L1026P probably damaging Het
Mtg1 T C 7: 140,138,370 V54A probably damaging Het
Mx1 G T 16: 97,451,487 C231* probably null Het
Olfr1129 G A 2: 87,575,739 M218I probably benign Het
Olfr478 C A 7: 108,031,863 W160L probably benign Het
Olfr507 A G 7: 108,621,820 I3V probably benign Het
Olfr680-ps1 A G 7: 105,090,958 V227A probably damaging Het
Olfr808 T A 10: 129,767,925 V143E probably damaging Het
Otogl T A 10: 107,857,114 E836D probably benign Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pon1 C T 6: 5,177,327 W194* probably null Het
Rbm25 T A 12: 83,664,251 S379R unknown Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Shoc2 A G 19: 53,988,072 Y131C probably damaging Het
Slc17a2 A T 13: 23,819,078 H237L probably benign Het
Slc23a1 T A 18: 35,624,436 M261L possibly damaging Het
Slc35d1 G C 4: 103,214,699 I35M Het
Slc8b1 C T 5: 120,513,138 probably benign Het
Smr3a A C 5: 88,004,752 L8F unknown Het
Snx8 G A 5: 140,358,174 R96C possibly damaging Het
Srgap3 A G 6: 112,775,548 V325A possibly damaging Het
Stk40 A G 4: 126,118,334 T10A probably benign Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Trim6 G A 7: 104,232,672 V403M probably damaging Het
Ttc25 G T 11: 100,561,905 probably null Het
Tysnd1 A G 10: 61,696,171 R201G probably benign Het
Vmn2r67 A T 7: 85,136,646 F717Y probably benign Het
Vmn2r72 A G 7: 85,738,175 V727A probably benign Het
Wdr49 A C 3: 75,451,690 D43E probably benign Het
Zbtb8b A G 4: 129,432,631 V247A probably benign Het
Zfp532 C A 18: 65,624,259 A421E possibly damaging Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1348:Abca3 UTSW 17 24374238 splice site probably null
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24384564 missense probably damaging 1.00
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5022:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24384535 missense probably damaging 1.00
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
R7338:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R7430:Abca3 UTSW 17 24364958 critical splice donor site probably null
R7437:Abca3 UTSW 17 24400498 missense probably damaging 0.99
R7776:Abca3 UTSW 17 24386276 missense possibly damaging 0.77
R7805:Abca3 UTSW 17 24405154 critical splice donor site probably null
R7811:Abca3 UTSW 17 24397388 missense probably benign 0.00
R7848:Abca3 UTSW 17 24384532 missense probably damaging 1.00
R7859:Abca3 UTSW 17 24384526 missense probably damaging 1.00
R7877:Abca3 UTSW 17 24384023 nonsense probably null
R7893:Abca3 UTSW 17 24385466 missense probably damaging 1.00
R7910:Abca3 UTSW 17 24385853 missense probably benign 0.09
R7911:Abca3 UTSW 17 24398504 missense probably damaging 1.00
R7964:Abca3 UTSW 17 24402436 missense probably benign 0.26
R8016:Abca3 UTSW 17 24364952 missense probably benign 0.06
R8028:Abca3 UTSW 17 24407697 missense probably benign 0.02
R8150:Abca3 UTSW 17 24396548 missense probably benign 0.08
R8298:Abca3 UTSW 17 24385401 missense probably damaging 1.00
R8505:Abca3 UTSW 17 24374497 missense probably damaging 0.97
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Z1177:Abca3 UTSW 17 24408236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAAGGCTCAGGTCATGTTTTGC -3'
(R):5'- TATACGGTCACAGTGCCACC -3'

Sequencing Primer
(F):5'- CATGTTCAGTGGGTCAATGGTAC -3'
(R):5'- CAGCATGTGGCCAGATGTG -3'
Posted On2020-10-20