Incidental Mutation 'R8903:Abca3'
ID 678340
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene Name ATP-binding cassette, sub-family A (ABC1), member 3
Synonyms ABC-C, 1810036E22Rik, Abc3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8903 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 24351950-24410201 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24383985 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 518 (Y518C)
Ref Sequence ENSEMBL: ENSMUSP00000045285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
AlphaFold Q8R420
Predicted Effect probably damaging
Transcript: ENSMUST00000039013
AA Change: Y518C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: Y518C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079594
AA Change: Y518C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: Y518C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117337
AA Change: Y518C
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: Y518C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik C T 1: 87,475,104 T52I probably damaging Het
Abca14 T C 7: 120,216,303 F258S probably damaging Het
Ank2 A T 3: 127,046,782 N274K probably damaging Het
Ankrd31 C T 13: 96,832,821 L989F probably damaging Het
Ano6 A G 15: 95,927,582 R354G probably benign Het
Ano8 T C 8: 71,482,190 probably null Het
Arfgef1 T C 1: 10,141,613 Y1735C probably damaging Het
B3gnt8 G A 7: 25,629,234 G363D probably benign Het
Calcrl T C 2: 84,373,385 probably null Het
Cc2d2b A T 19: 40,809,282 D782V unknown Het
Ccdc162 A G 10: 41,655,444 probably null Het
Cdkal1 A T 13: 29,625,935 *219R probably null Het
Clcnkb A T 4: 141,407,849 V526D possibly damaging Het
Cnbp A T 6: 87,844,092 C162S probably damaging Het
Coq2 A G 5: 100,663,790 probably benign Het
D6Wsu163e T A 6: 126,954,815 L270Q probably damaging Het
Dnhd1 C T 7: 105,713,648 Q3806* probably null Het
Eepd1 T C 9: 25,483,222 F261L probably benign Het
Fam45a C T 19: 60,834,985 Q353* probably null Het
Fes C T 7: 80,386,811 probably benign Het
Fsip2 T A 2: 82,977,337 D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm5113 T C 7: 30,178,867 F127L probably benign Het
Grk3 A G 5: 112,918,831 S596P possibly damaging Het
Gsk3a A G 7: 25,237,389 V91A possibly damaging Het
Gss T C 2: 155,578,359 K141E probably damaging Het
Il1rl2 A T 1: 40,327,370 probably null Het
Kcnmb1 A G 11: 33,964,825 Y42C probably damaging Het
Krtap16-1 A T 11: 99,986,344 I78N probably damaging Het
Lrp2 C T 2: 69,549,038 S110N possibly damaging Het
Lrrfip1 T A 1: 91,085,059 probably benign Het
Magel2 G T 7: 62,379,693 A782S unknown Het
Map1b C A 13: 99,432,509 E1235* probably null Het
Mcpt1 A C 14: 56,020,063 H222P probably benign Het
Met T A 6: 17,549,138 N996K probably benign Het
Mia C A 7: 27,180,805 Q52H probably damaging Het
Mia T A 7: 27,180,806 Q52L possibly damaging Het
Myh7 T A 14: 54,992,771 K35* probably null Het
Myt1l T A 12: 29,811,469 D83E unknown Het
Nbl1 A G 4: 139,083,550 V111A probably damaging Het
Nid1 T A 13: 13,463,930 V145D probably benign Het
Nif3l1 C T 1: 58,447,494 probably benign Het
Npnt T C 3: 132,886,003 Y500C probably damaging Het
Nubpl T A 12: 52,097,893 probably null Het
Nxpe4 T A 9: 48,398,950 D504E probably damaging Het
Obsl1 A G 1: 75,487,273 V1696A possibly damaging Het
Olfr283 A T 15: 98,378,594 I172N probably damaging Het
Olfr679 A T 7: 105,086,122 R135S possibly damaging Het
P2rx1 A T 11: 73,009,995 H224L probably benign Het
Pald1 A T 10: 61,347,036 probably null Het
Pard6g C T 18: 80,117,196 R175* probably null Het
Pisd A G 5: 32,738,411 I271T probably benign Het
Prrt3 T C 6: 113,495,835 S459G probably damaging Het
Psd3 A T 8: 67,713,293 C328S unknown Het
Psme1 A G 14: 55,580,396 E120G Het
Pum3 A T 19: 27,420,057 M306K possibly damaging Het
Pxdn T C 12: 29,990,993 F423L probably benign Het
Rac3 A G 11: 120,723,245 D118G probably damaging Het
Rnf14 A G 18: 38,313,214 K357E probably benign Het
Rpl23a T C 11: 78,182,894 I40V probably benign Het
Slc5a5 A T 8: 70,892,583 S27T probably damaging Het
Slc7a14 A T 3: 31,223,446 L670Q probably damaging Het
Sst T A 16: 23,889,749 K111* probably null Het
Stxbp4 A G 11: 90,535,441 S514P unknown Het
Susd1 T A 4: 59,390,576 T300S probably benign Het
Tecpr1 C T 5: 144,214,027 probably benign Het
Tmem185b C T 1: 119,526,468 probably benign Het
Tor2a T A 2: 32,761,687 F305I probably damaging Het
Ttk T A 9: 83,868,060 D689E probably damaging Het
Usp25 A G 16: 77,081,533 D615G probably damaging Het
Vmn1r209 A G 13: 22,806,514 V2A probably benign Het
Vmn2r80 A C 10: 79,182,094 E551A probably damaging Het
Wac G T 18: 7,926,104 E636* probably null Het
Wdr53 T A 16: 32,252,312 D158E probably damaging Het
Zbtb7c T C 18: 76,137,081 V80A probably damaging Het
Zcchc11 A T 4: 108,479,211 D44V probably damaging Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1348:Abca3 UTSW 17 24374238 splice site probably null
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24384564 missense probably damaging 1.00
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5022:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24384535 missense probably damaging 1.00
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
R7338:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R7430:Abca3 UTSW 17 24364958 critical splice donor site probably null
R7437:Abca3 UTSW 17 24400498 missense probably damaging 0.99
R7776:Abca3 UTSW 17 24386276 missense possibly damaging 0.77
R7805:Abca3 UTSW 17 24405154 critical splice donor site probably null
R7811:Abca3 UTSW 17 24397388 missense probably benign 0.00
R7848:Abca3 UTSW 17 24384532 missense probably damaging 1.00
R7859:Abca3 UTSW 17 24384526 missense probably damaging 1.00
R7877:Abca3 UTSW 17 24384023 nonsense probably null
R7893:Abca3 UTSW 17 24385466 missense probably damaging 1.00
R7910:Abca3 UTSW 17 24385853 missense probably benign 0.09
R7911:Abca3 UTSW 17 24398504 missense probably damaging 1.00
R7964:Abca3 UTSW 17 24402436 missense probably benign 0.26
R8016:Abca3 UTSW 17 24364952 missense probably benign 0.06
R8028:Abca3 UTSW 17 24407697 missense probably benign 0.02
R8150:Abca3 UTSW 17 24396548 missense probably benign 0.08
R8298:Abca3 UTSW 17 24385401 missense probably damaging 1.00
R8444:Abca3 UTSW 17 24383985 missense probably damaging 0.98
R8505:Abca3 UTSW 17 24374497 missense probably damaging 0.97
R8547:Abca3 UTSW 17 24397500 missense probably benign 0.00
R8699:Abca3 UTSW 17 24408225 missense probably benign 0.01
R9046:Abca3 UTSW 17 24398503 missense probably damaging 1.00
R9136:Abca3 UTSW 17 24377833 missense probably benign 0.01
R9236:Abca3 UTSW 17 24407738 missense probably benign 0.16
R9331:Abca3 UTSW 17 24397350 missense probably benign 0.00
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Z1177:Abca3 UTSW 17 24408236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATGTTCAGTGGGTCAATGGTAC -3'
(R):5'- TATACGGTCACAGTGCCACC -3'

Sequencing Primer
(F):5'- GGTACTTATTTTGTTGGTTGCAAAC -3'
(R):5'- CAGCATGTGGCCAGATGTG -3'
Posted On 2021-08-02