Mutagenetix > Incidental Mutations

Incidental Mutation 'R4091:Abca3'

317640

Institutional Source

Beutler Lab

Gene Symbol

Abca3

Ensembl Gene

ENSMUSG00000024130

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 3

Synonyms

ABC-C, 1810036E22Rik, Abc3

MMRRC Submission

041626-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24351950-24410201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 24397482 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 966 (T966M)

Ref Sequence

ENSEMBL: ENSMUSP00000078544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]

AlphaFold

Q8R420

Predicted Effect

probably damaging
Transcript: ENSMUST00000039013
AA Change: T966M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: T966M

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	21	469	2.1e-29	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	923	1323	1.8e-35	PFAM
AAA	1408	1592	1.64e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000079594
AA Change: T966M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: T966M

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	22	469	2.6e-28	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	923	1323	5.5e-39	PFAM
AAA	1408	1592	1.64e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117337

SMART Domains

Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	21	469	1.3e-29	PFAM
AAA	558	740	5.17e-10	SMART
Pfam:ABC2_membrane_3	761	1068	8.8e-29	PFAM
AAA	1153	1337	1.64e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133816

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148557

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,745,378	S674P	possibly damaging	Het
4932438A13Rik	G	A	3: 37,030,589	A3897T	probably benign	Het
A530099J19Rik	T	A	13: 19,729,465		noncoding transcript	Het
Adam2	A	T	14: 66,029,723	Y696N	probably damaging	Het
Aes	G	A	10: 81,565,584	G162D	probably damaging	Het
Alas1	G	T	9: 106,241,801		probably null	Het
Arhgap25	G	T	6: 87,463,035	S543R	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Carns1	C	T	19: 4,171,683	R191Q	probably damaging	Het
Casp8ap2	C	A	4: 32,643,611	P895T	probably damaging	Het
Col12a1	T	A	9: 79,702,364	I287F	probably damaging	Het
Cystm1	A	G	18: 36,366,547	N5S	unknown	Het
Dnah8	T	C	17: 30,769,839	V3261A	probably damaging	Het
Dnajc11	A	G	4: 151,978,093		probably benign	Het
Dock4	T	C	12: 40,844,267	S1847P	probably damaging	Het
Dync2h1	A	G	9: 7,131,881	V1642A	probably benign	Het
Eftud2	T	C	11: 102,839,416		probably null	Het
Fam221b	A	G	4: 43,665,987	I208T	probably benign	Het
Gpr37l1	T	C	1: 135,161,563	I255V	probably benign	Het
Grm7	G	A	6: 110,914,340	S178N	probably damaging	Het
Hspa12b	T	A	2: 131,133,488		probably null	Het
Kctd3	A	T	1: 188,995,720		probably benign	Het
Kynu	G	A	2: 43,679,872	V389M	possibly damaging	Het
Lcat	A	G	8: 105,939,906	L328P	probably benign	Het
Lrrn2	C	T	1: 132,937,652	Q152*	probably null	Het
Maml1	G	A	11: 50,291,829	P78L	probably benign	Het
Mef2b	G	A	8: 70,165,102	V37M	probably damaging	Het
Mindy2	A	T	9: 70,634,060	M281K	probably damaging	Het
Mon2	C	T	10: 123,038,510	R311H	probably damaging	Het
Mtr	A	T	13: 12,231,057	V394E	probably damaging	Het
Myh14	T	A	7: 44,632,991	T745S	possibly damaging	Het
Nme9	T	A	9: 99,464,527	D131E	possibly damaging	Het
Nphp4	C	A	4: 152,547,018	Q792K	probably damaging	Het
Nrxn2	T	A	19: 6,473,414	C479S	probably damaging	Het
Nsmf	T	C	2: 25,060,859	I406T	probably damaging	Het
Olfr1431	A	T	19: 12,209,779	D71V	probably damaging	Het
Olfr517	G	A	7: 108,868,443	A237V	probably damaging	Het
Olfr945	T	A	9: 39,258,034	I213F	possibly damaging	Het
Pbrm1	A	G	14: 31,036,003	T197A	probably benign	Het
Pla2r1	T	A	2: 60,432,593	N1034I	probably damaging	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp1	A	T	3: 79,644,761	D744E	probably benign	Het
Samd9l	T	C	6: 3,376,887	N125D	probably benign	Het
Serpina3a	G	A	12: 104,116,366	V133I	probably benign	Het
Slc22a30	C	T	19: 8,404,545	V121M	probably damaging	Het
Smarcc1	T	A	9: 110,164,829	D247E	possibly damaging	Het
Smg9	T	A	7: 24,420,867	L422Q	probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Utrn	T	A	10: 12,710,171	D954V	probably benign	Het
Vmn1r227	T	A	17: 20,735,516		noncoding transcript	Het
Vmn2r11	A	C	5: 109,054,750		probably null	Het
Vmn2r84	A	T	10: 130,391,369	M200K	probably damaging	Het
Vmn2r88	T	A	14: 51,415,426	Y469N	probably damaging	Het
Wdcp	A	G	12: 4,855,279	N600S	probably null	Het
Wdfy4	T	G	14: 33,125,880	R838S	possibly damaging	Het

Other mutations in Abca3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Abca3	APN	17	24374246	missense	probably damaging	1.00
IGL01538:Abca3	APN	17	24376473	missense	possibly damaging	0.64
IGL01633:Abca3	APN	17	24397353	nonsense	probably null
IGL01837:Abca3	APN	17	24408697	missense	probably damaging	1.00
IGL01986:Abca3	APN	17	24408114	missense	probably damaging	1.00
IGL02049:Abca3	APN	17	24376730	nonsense	probably null
IGL02186:Abca3	APN	17	24377740	missense	possibly damaging	0.95
IGL02794:Abca3	APN	17	24402411	missense	probably benign	0.05
IGL02962:Abca3	APN	17	24400409	missense	probably damaging	1.00
IGL02963:Abca3	APN	17	24384529	missense	probably damaging	1.00
IGL03118:Abca3	APN	17	24400450	missense	probably benign	0.17
IGL03144:Abca3	APN	17	24381964	missense	probably benign	0.37
R0028:Abca3	UTSW	17	24377724	missense	probably benign	0.39
R0278:Abca3	UTSW	17	24381920	missense	probably benign	0.09
R0570:Abca3	UTSW	17	24374399	missense	probably benign
R0825:Abca3	UTSW	17	24400577	missense	probably damaging	1.00
R1164:Abca3	UTSW	17	24402331	missense	probably damaging	1.00
R1348:Abca3	UTSW	17	24374238	splice site	probably null
R1557:Abca3	UTSW	17	24399980	missense	possibly damaging	0.46
R1661:Abca3	UTSW	17	24377842	missense	probably damaging	0.99
R1665:Abca3	UTSW	17	24377842	missense	probably damaging	0.99
R1754:Abca3	UTSW	17	24377779	missense	probably benign	0.00
R1828:Abca3	UTSW	17	24366197	missense	probably benign	0.34
R1834:Abca3	UTSW	17	24376692	missense	probably benign	0.00
R1996:Abca3	UTSW	17	24387532	missense	probably damaging	1.00
R2032:Abca3	UTSW	17	24366082	splice site	probably benign
R2100:Abca3	UTSW	17	24408209	missense	probably damaging	0.99
R2154:Abca3	UTSW	17	24377719	missense	probably damaging	1.00
R2240:Abca3	UTSW	17	24376443	missense	probably damaging	0.98
R2281:Abca3	UTSW	17	24376726	missense	possibly damaging	0.88
R2994:Abca3	UTSW	17	24384564	missense	probably damaging	1.00
R4294:Abca3	UTSW	17	24400569	missense	possibly damaging	0.96
R4496:Abca3	UTSW	17	24383973	missense	possibly damaging	0.93
R4633:Abca3	UTSW	17	24387529	missense	probably null	1.00
R4866:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5022:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5023:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5072:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5073:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5074:Abca3	UTSW	17	24374300	missense	probably damaging	0.97
R5123:Abca3	UTSW	17	24384460	missense	possibly damaging	0.95
R5157:Abca3	UTSW	17	24408122	missense	probably damaging	1.00
R5183:Abca3	UTSW	17	24374453	missense	probably benign	0.39
R5269:Abca3	UTSW	17	24376743	missense	possibly damaging	0.95
R5566:Abca3	UTSW	17	24383927	missense	probably benign
R5579:Abca3	UTSW	17	24376729	missense	probably damaging	0.97
R5620:Abca3	UTSW	17	24396470	missense	probably benign	0.05
R5755:Abca3	UTSW	17	24398454	missense	probably damaging	1.00
R5954:Abca3	UTSW	17	24397416	missense	probably benign	0.00
R6041:Abca3	UTSW	17	24376380	missense	probably damaging	0.99
R6187:Abca3	UTSW	17	24408167	missense	possibly damaging	0.88
R6253:Abca3	UTSW	17	24397552	missense	probably benign	0.01
R6375:Abca3	UTSW	17	24387562	missense	possibly damaging	0.96
R6487:Abca3	UTSW	17	24397472	missense	possibly damaging	0.81
R6616:Abca3	UTSW	17	24384535	missense	probably damaging	1.00
R6632:Abca3	UTSW	17	24384470	missense	probably benign
R6781:Abca3	UTSW	17	24374406	missense	possibly damaging	0.95
R6918:Abca3	UTSW	17	24408658	missense	probably damaging	1.00
R6962:Abca3	UTSW	17	24364726	missense	probably benign	0.39
R7163:Abca3	UTSW	17	24364942	missense	probably benign
R7199:Abca3	UTSW	17	24377707	missense	probably damaging	1.00
R7287:Abca3	UTSW	17	24385887	missense	possibly damaging	0.91
R7303:Abca3	UTSW	17	24398521	missense	possibly damaging	0.83
R7338:Abca3	UTSW	17	24376743	missense	possibly damaging	0.95
R7430:Abca3	UTSW	17	24364958	critical splice donor site	probably null
R7437:Abca3	UTSW	17	24400498	missense	probably damaging	0.99
R7776:Abca3	UTSW	17	24386276	missense	possibly damaging	0.77
R7805:Abca3	UTSW	17	24405154	critical splice donor site	probably null
R7811:Abca3	UTSW	17	24397388	missense	probably benign	0.00
R7848:Abca3	UTSW	17	24384532	missense	probably damaging	1.00
R7859:Abca3	UTSW	17	24384526	missense	probably damaging	1.00
R7877:Abca3	UTSW	17	24384023	nonsense	probably null
R7893:Abca3	UTSW	17	24385466	missense	probably damaging	1.00
R7910:Abca3	UTSW	17	24385853	missense	probably benign	0.09
R7911:Abca3	UTSW	17	24398504	missense	probably damaging	1.00
R7964:Abca3	UTSW	17	24402436	missense	probably benign	0.26
R8016:Abca3	UTSW	17	24364952	missense	probably benign	0.06
R8028:Abca3	UTSW	17	24407697	missense	probably benign	0.02
R8150:Abca3	UTSW	17	24396548	missense	probably benign	0.08
R8298:Abca3	UTSW	17	24385401	missense	probably damaging	1.00
R8444:Abca3	UTSW	17	24383985	missense	probably damaging	0.98
R8505:Abca3	UTSW	17	24374497	missense	probably damaging	0.97
R8547:Abca3	UTSW	17	24397500	missense	probably benign	0.00
R8699:Abca3	UTSW	17	24408225	missense	probably benign	0.01
R8903:Abca3	UTSW	17	24383985	missense	probably damaging	0.98
R9046:Abca3	UTSW	17	24398503	missense	probably damaging	1.00
R9136:Abca3	UTSW	17	24377833	missense	probably benign	0.01
R9236:Abca3	UTSW	17	24407738	missense	probably benign	0.16
R9331:Abca3	UTSW	17	24397350	missense	probably benign	0.00
X0018:Abca3	UTSW	17	24396480	missense	possibly damaging	0.63
Z1177:Abca3	UTSW	17	24408236	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAGTTCTGGGCCATGTTC -3'
(R):5'- GGGATGCTAACTGTGCTATGAAG -3'

Sequencing Primer
(F):5'- CATGTTCCTGAAGAAGGCTGCATAC -3'
(R):5'- CTGTGCTATGAAGGCAAAGGAC -3'

Posted On

2015-05-15