Incidental Mutation 'R8447:Clec16a'
ID654575
Institutional Source Beutler Lab
Gene Symbol Clec16a
Ensembl Gene ENSMUSG00000068663
Gene NameC-type lectin domain family 16, member A
Synonyms4932416N17Rik, curt
Accession Numbers

NCBI RefSeq: NM_177562.5, NM_001204229.1; MGI: 1921624

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R8447 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location10545339-10744878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10741623 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 920 (T920K)
Ref Sequence ENSEMBL: ENSMUSP00000123189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066345] [ENSMUST00000115823] [ENSMUST00000115824] [ENSMUST00000115828] [ENSMUST00000155633]
Predicted Effect probably benign
Transcript: ENSMUST00000066345
AA Change: T922K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065423
Gene: ENSMUSG00000068663
AA Change: T922K

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115823
SMART Domains Protein: ENSMUSP00000111489
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
low complexity region 456 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115824
AA Change: T922K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111490
Gene: ENSMUSG00000068663
AA Change: T922K

DomainStartEndE-ValueType
Pfam:FPL 51 198 5.9e-66 PFAM
coiled coil region 398 419 N/A INTRINSIC
low complexity region 877 924 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115828
SMART Domains Protein: ENSMUSP00000111494
Gene: ENSMUSG00000068663

DomainStartEndE-ValueType
Pfam:FPL 51 199 2.1e-61 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155633
AA Change: T920K

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123189
Gene: ENSMUSG00000068663
AA Change: T920K

DomainStartEndE-ValueType
Pfam:FPL 51 199 1.1e-60 PFAM
coiled coil region 396 417 N/A INTRINSIC
low complexity region 875 922 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin domain containing family. Single nucleotide polymorphisms in introns of this gene have been associated with diabetes mellitus, multiple sclerosis and rheumatoid arthritis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation have a curved tail, small body size, squinting eyes, crooked digits that curve outward, and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A C 5: 8,907,278 T136P probably damaging Het
Abcc3 A T 11: 94,364,060 L639Q possibly damaging Het
Adam10 T A 9: 70,748,118 N289K probably damaging Het
Akap12 A G 10: 4,356,289 E1138G probably benign Het
Akr1e1 C A 13: 4,598,794 L167F probably damaging Het
Cars T C 7: 143,570,029 K506E possibly damaging Het
Cfap46 C A 7: 139,680,986 R65S possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Coro2b C T 9: 62,426,560 E351K probably damaging Het
Diablo T C 5: 123,517,766 E163G probably damaging Het
Dnah6 A G 6: 73,138,774 L1547P probably damaging Het
Dynll2 G T 11: 87,983,893 D37E probably benign Het
Eml4 A T 17: 83,448,227 Q408L probably damaging Het
F2rl3 T C 8: 72,763,335 *397R probably null Het
Fance T A 17: 28,326,181 L127Q unknown Het
Fat4 T C 3: 38,979,675 V2492A possibly damaging Het
Gatsl3 T C 11: 4,220,165 V81A probably damaging Het
Ggta1 C T 2: 35,402,561 D245N probably damaging Het
Gli1 T C 10: 127,330,237 N1049S probably benign Het
Grin2c A G 11: 115,257,389 V354A probably benign Het
Kank4 T A 4: 98,778,492 I573F probably damaging Het
Kdm3a A G 6: 71,611,897 V376A probably benign Het
Kndc1 T C 7: 139,901,205 V69A probably damaging Het
Lcmt1 T A 7: 123,421,602 L250Q probably damaging Het
Ldhb A T 6: 142,498,630 V99D probably damaging Het
Lepr T C 4: 101,814,491 V904A probably benign Het
Lipe G T 7: 25,380,592 N710K probably damaging Het
Med1 C A 11: 98,169,414 D230Y probably damaging Het
Mpv17l T A 16: 13,941,000 I96K probably benign Het
Obox1 A T 7: 15,555,616 Q110L probably damaging Het
Olfr1101 T A 2: 86,988,541 I212F probably benign Het
Olfr1281 T A 2: 111,328,962 I181N possibly damaging Het
Olfr1289 T A 2: 111,483,756 Y137N probably damaging Het
Olfr1410 C A 1: 92,607,772 probably benign Het
Olfr745 T C 14: 50,642,551 V84A probably benign Het
Olfr809 T G 10: 129,776,502 M211R possibly damaging Het
Pah T C 10: 87,581,965 probably null Het
Pate1 A T 9: 35,686,335 N40K probably benign Het
Pclo C A 5: 14,681,409 D182E Het
Prl7a2 A T 13: 27,665,958 S44T possibly damaging Het
Pwp2 T A 10: 78,172,039 D894V probably benign Het
Ripor2 T A 13: 24,723,788 L1014Q probably damaging Het
Rpe G A 1: 66,701,029 probably null Het
Sh2d3c A G 2: 32,752,659 T706A probably damaging Het
Slc17a2 T C 13: 23,822,326 F445S possibly damaging Het
Spata20 C A 11: 94,482,254 L515F probably damaging Het
Tcf20 G A 15: 82,853,236 S1338F possibly damaging Het
Tm9sf2 C A 14: 122,139,768 P236Q probably damaging Het
Tmem135 T C 7: 89,154,032 Y311C probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tmem94 G T 11: 115,797,197 C1190F possibly damaging Het
Tmem94 G A 11: 115,797,870 R1301H probably benign Het
Zp3 G A 5: 135,984,390 G192E probably damaging Het
Other mutations in Clec16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Clec16a APN 16 10595896 missense probably damaging 1.00
IGL00503:Clec16a APN 16 10694649 missense possibly damaging 0.53
IGL01622:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL01623:Clec16a APN 16 10577910 missense possibly damaging 0.47
IGL02008:Clec16a APN 16 10580960 missense probably damaging 1.00
IGL02082:Clec16a APN 16 10614568 missense probably damaging 1.00
IGL02468:Clec16a APN 16 10741878 missense probably benign 0.13
IGL02499:Clec16a APN 16 10694676 missense probably benign 0.25
IGL02671:Clec16a APN 16 10627381 missense probably benign 0.19
G5030:Clec16a UTSW 16 10571561 missense probably damaging 1.00
IGL03055:Clec16a UTSW 16 10741781 missense probably damaging 0.99
P0014:Clec16a UTSW 16 10560156 splice site probably benign
R0183:Clec16a UTSW 16 10560022 missense probably damaging 1.00
R0268:Clec16a UTSW 16 10644828 nonsense probably null
R0512:Clec16a UTSW 16 10614580 missense probably damaging 1.00
R0556:Clec16a UTSW 16 10638785 critical splice acceptor site probably null
R0944:Clec16a UTSW 16 10688646 splice site probably benign
R1456:Clec16a UTSW 16 10691555 missense probably damaging 1.00
R1497:Clec16a UTSW 16 10635259 missense probably damaging 1.00
R1580:Clec16a UTSW 16 10595898 missense probably damaging 1.00
R1933:Clec16a UTSW 16 10688539 missense probably damaging 0.99
R2075:Clec16a UTSW 16 10741616 missense probably benign 0.09
R2269:Clec16a UTSW 16 10644786 missense probably damaging 1.00
R2504:Clec16a UTSW 16 10559687 intron probably benign
R3011:Clec16a UTSW 16 10611111 missense probably benign 0.01
R4331:Clec16a UTSW 16 10571669 missense probably benign
R4616:Clec16a UTSW 16 10644883 critical splice donor site probably null
R4775:Clec16a UTSW 16 10638914 missense probably damaging 1.00
R4969:Clec16a UTSW 16 10568511 missense probably damaging 1.00
R5053:Clec16a UTSW 16 10576597 missense probably damaging 1.00
R5170:Clec16a UTSW 16 10741791 missense probably benign
R5329:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5331:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5332:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5417:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5419:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5420:Clec16a UTSW 16 10731679 missense probably damaging 0.99
R5457:Clec16a UTSW 16 10545532 splice site probably null
R5623:Clec16a UTSW 16 10611121 missense probably benign 0.07
R6057:Clec16a UTSW 16 10630087 missense probably damaging 1.00
R6184:Clec16a UTSW 16 10572928 splice site probably null
R6235:Clec16a UTSW 16 10694635 missense probably damaging 1.00
R6260:Clec16a UTSW 16 10694848 intron probably benign
R6292:Clec16a UTSW 16 10560151 critical splice donor site probably null
R6318:Clec16a UTSW 16 10630788 missense probably damaging 1.00
R6894:Clec16a UTSW 16 10644854 missense probably damaging 1.00
R7340:Clec16a UTSW 16 10580963 missense probably null 0.21
R7432:Clec16a UTSW 16 10688555 missense possibly damaging 0.62
R7453:Clec16a UTSW 16 10644822 missense probably damaging 1.00
R7536:Clec16a UTSW 16 10638844 missense possibly damaging 0.90
R8207:Clec16a UTSW 16 10627448 missense probably benign 0.00
R8207:Clec16a UTSW 16 10694710 missense probably damaging 1.00
R8423:Clec16a UTSW 16 10576663 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCACAAGTCAGGTACCCAAG -3'
(R):5'- AGTGTGTCAGCAGTGTCCTC -3'

Sequencing Primer
(F):5'- TCCCTAGGCCTAAGTTAGATGAAGC -3'
(R):5'- TCGTAGAGCAAGGAGATGGTG -3'
Posted On2020-10-20