Incidental Mutation 'R0370:Kcnn3'
ID 65596
Institutional Source Beutler Lab
Gene Symbol Kcnn3
Ensembl Gene ENSMUSG00000000794
Gene Name potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms SK3, small conductance calcium-activated potassium channel 3
MMRRC Submission 038576-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.514) question?
Stock # R0370 (G1)
Quality Score 130
Status Not validated
Chromosome 3
Chromosomal Location 89427471-89579801 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89574399 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 637 (N637I)
Ref Sequence ENSEMBL: ENSMUSP00000000811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000811]
AlphaFold P58391
Predicted Effect probably damaging
Transcript: ENSMUST00000000811
AA Change: N637I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: N637I

DomainStartEndE-ValueType
low complexity region 30 96 N/A INTRINSIC
low complexity region 139 154 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Pfam:SK_channel 270 383 3.1e-51 PFAM
Pfam:Ion_trans_2 462 548 2.2e-14 PFAM
CaMBD 562 638 1.04e-49 SMART
low complexity region 684 690 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124584
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 T C 8: 124,228,293 (GRCm39) S666P probably damaging Het
B3gntl1 A T 11: 121,514,980 (GRCm39) W263R probably damaging Het
Carmil3 A G 14: 55,732,899 (GRCm39) N270S possibly damaging Het
Ctdp1 T C 18: 80,492,569 (GRCm39) E642G probably damaging Het
Cyp2b9 A T 7: 25,909,531 (GRCm39) K433M probably damaging Het
Dcc A G 18: 71,721,056 (GRCm39) V435A possibly damaging Het
Defa26 A T 8: 22,108,875 (GRCm39) M87L probably benign Het
Dnah11 T A 12: 117,958,962 (GRCm39) I2974L probably benign Het
Dnah3 T C 7: 119,685,943 (GRCm39) D131G possibly damaging Het
Dock6 A T 9: 21,725,861 (GRCm39) S1447R probably benign Het
Dtl G T 1: 191,307,462 (GRCm39) N17K probably benign Het
Grid2 A G 6: 64,322,718 (GRCm39) I573V possibly damaging Het
Hoxa9 T C 6: 52,202,684 (GRCm39) E134G possibly damaging Het
Ktn1 T C 14: 47,901,532 (GRCm39) F97L probably benign Het
Lmbrd2 T C 15: 9,165,939 (GRCm39) I271T probably damaging Het
Lrp6 A C 6: 134,456,729 (GRCm39) I845S probably damaging Het
Med13l T A 5: 118,879,891 (GRCm39) N994K probably benign Het
Mrrf A T 2: 36,067,125 (GRCm39) probably null Het
Mtmr1 G A X: 70,431,837 (GRCm39) V125I probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Or13g1 T A 7: 85,956,057 (GRCm39) N88I probably benign Het
Or51k1 T G 7: 103,661,266 (GRCm39) L214F probably damaging Het
Or8k3 A T 2: 86,059,057 (GRCm39) V86D probably damaging Het
Paxip1 C A 5: 27,965,084 (GRCm39) V659F probably damaging Het
Pclo T C 5: 14,571,104 (GRCm39) V163A probably damaging Het
Pkn3 T A 2: 29,977,184 (GRCm39) H641Q probably damaging Het
Plekhg6 G A 6: 125,347,623 (GRCm39) R444C probably damaging Het
Rfx2 T C 17: 57,106,308 (GRCm39) E175G probably benign Het
Samd9l A C 6: 3,377,264 (GRCm39) probably benign Het
Sec14l5 A T 16: 4,998,570 (GRCm39) T537S probably damaging Het
Serpinb9d A G 13: 33,379,949 (GRCm39) E96G probably damaging Het
Setd4 T C 16: 93,388,006 (GRCm39) E160G probably damaging Het
Sf3b2 C T 19: 5,324,852 (GRCm39) D845N probably damaging Het
Slc16a4 A G 3: 107,208,413 (GRCm39) I308V possibly damaging Het
Slco2b1 T A 7: 99,339,644 (GRCm39) N100Y probably damaging Het
Sptbn1 A T 11: 30,071,545 (GRCm39) S1475R probably benign Het
Tecta T C 9: 42,278,100 (GRCm39) D1136G probably benign Het
Tmem94 G C 11: 115,679,543 (GRCm39) R273S probably damaging Het
Tns3 A G 11: 8,395,730 (GRCm39) S1225P possibly damaging Het
Ugt2b36 A G 5: 87,239,834 (GRCm39) Y184H probably benign Het
Vmn2r59 A T 7: 41,662,150 (GRCm39) M555K probably benign Het
Other mutations in Kcnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02263:Kcnn3 APN 3 89,568,525 (GRCm39) missense possibly damaging 0.73
IGL02444:Kcnn3 APN 3 89,559,359 (GRCm39) missense possibly damaging 0.50
IGL02500:Kcnn3 APN 3 89,568,419 (GRCm39) splice site probably benign
IGL02814:Kcnn3 APN 3 89,428,482 (GRCm39) missense possibly damaging 0.94
IGL02821:Kcnn3 APN 3 89,428,281 (GRCm39) missense possibly damaging 0.91
IGL02821:Kcnn3 APN 3 89,570,029 (GRCm39) missense possibly damaging 0.84
IGL02852:Kcnn3 APN 3 89,516,923 (GRCm39) missense probably damaging 0.96
IGL02942:Kcnn3 APN 3 89,559,383 (GRCm39) missense probably benign 0.00
IGL03118:Kcnn3 APN 3 89,574,468 (GRCm39) missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89,570,080 (GRCm39) missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89,570,080 (GRCm39) missense probably damaging 1.00
R0032:Kcnn3 UTSW 3 89,427,972 (GRCm39) small deletion probably benign
R0619:Kcnn3 UTSW 3 89,559,337 (GRCm39) missense probably damaging 1.00
R1167:Kcnn3 UTSW 3 89,472,259 (GRCm39) nonsense probably null
R1255:Kcnn3 UTSW 3 89,559,416 (GRCm39) missense possibly damaging 0.84
R1643:Kcnn3 UTSW 3 89,427,804 (GRCm39) missense unknown
R1733:Kcnn3 UTSW 3 89,559,397 (GRCm39) missense probably benign 0.00
R1793:Kcnn3 UTSW 3 89,516,712 (GRCm39) missense probably benign 0.20
R1827:Kcnn3 UTSW 3 89,428,301 (GRCm39) missense possibly damaging 0.75
R1899:Kcnn3 UTSW 3 89,427,762 (GRCm39) start gained probably benign
R2055:Kcnn3 UTSW 3 89,428,682 (GRCm39) missense probably damaging 1.00
R2843:Kcnn3 UTSW 3 89,427,972 (GRCm39) small deletion probably benign
R2922:Kcnn3 UTSW 3 89,428,329 (GRCm39) missense probably damaging 1.00
R4078:Kcnn3 UTSW 3 89,568,495 (GRCm39) missense possibly damaging 0.68
R4227:Kcnn3 UTSW 3 89,428,482 (GRCm39) missense possibly damaging 0.94
R4604:Kcnn3 UTSW 3 89,427,727 (GRCm39) start gained probably benign
R4814:Kcnn3 UTSW 3 89,570,031 (GRCm39) missense probably damaging 1.00
R4822:Kcnn3 UTSW 3 89,574,596 (GRCm39) missense possibly damaging 0.93
R5175:Kcnn3 UTSW 3 89,516,746 (GRCm39) missense probably damaging 1.00
R5211:Kcnn3 UTSW 3 89,428,538 (GRCm39) missense probably benign 0.04
R5438:Kcnn3 UTSW 3 89,428,605 (GRCm39) missense probably damaging 1.00
R5496:Kcnn3 UTSW 3 89,516,797 (GRCm39) missense possibly damaging 0.95
R6244:Kcnn3 UTSW 3 89,552,830 (GRCm39) nonsense probably null
R7391:Kcnn3 UTSW 3 89,516,778 (GRCm39) missense probably benign 0.34
R7625:Kcnn3 UTSW 3 89,516,977 (GRCm39) missense probably damaging 0.99
R7834:Kcnn3 UTSW 3 89,428,661 (GRCm39) missense probably damaging 1.00
R8022:Kcnn3 UTSW 3 89,517,010 (GRCm39) missense possibly damaging 0.92
R8110:Kcnn3 UTSW 3 89,568,540 (GRCm39) missense probably damaging 0.99
R8220:Kcnn3 UTSW 3 89,568,548 (GRCm39) missense probably benign 0.14
R8787:Kcnn3 UTSW 3 89,552,757 (GRCm39) missense possibly damaging 0.93
R9124:Kcnn3 UTSW 3 89,428,536 (GRCm39) missense possibly damaging 0.47
R9256:Kcnn3 UTSW 3 89,574,407 (GRCm39) missense probably damaging 1.00
R9612:Kcnn3 UTSW 3 89,516,703 (GRCm39) missense probably benign 0.09
Z1088:Kcnn3 UTSW 3 89,574,437 (GRCm39) missense probably damaging 1.00
Z1177:Kcnn3 UTSW 3 89,568,443 (GRCm39) missense possibly damaging 0.72
Z1177:Kcnn3 UTSW 3 89,428,230 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGTCCATCACCTGGGAAG -3'
(R):5'- GGCATATCGAACAAAGCACGCTG -3'

Sequencing Primer
(F):5'- GAGGGCATTTCATCTTCCCA -3'
(R):5'- AGCAACTGCTTGAACTTGTG -3'
Posted On 2013-08-08