Incidental Mutation 'R8470:Adamts16'
ID 657003
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 16
Synonyms
MMRRC Submission 067914-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8470 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 70875921-70989930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70984496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 56 (Y56H)
Ref Sequence ENSEMBL: ENSMUSP00000122031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
AlphaFold Q69Z28
Predicted Effect probably damaging
Transcript: ENSMUST00000080145
AA Change: Y56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: Y56H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109694
AA Change: Y56H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: Y56H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123552
AA Change: Y56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538
AA Change: Y56H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas2 A T 7: 132,476,685 (GRCm39) I142F probably damaging Het
Alms1 A G 6: 85,618,357 (GRCm39) D2801G probably damaging Het
Anpep A G 7: 79,489,269 (GRCm39) I301T probably benign Het
Atxn7l2 G A 3: 108,114,285 (GRCm39) T159M probably benign Het
B130006D01Rik C T 11: 95,617,175 (GRCm39) probably benign Het
Btf3l4b C A 13: 96,217,432 (GRCm39) D136Y possibly damaging Het
Ccdc175 T C 12: 72,202,392 (GRCm39) K301R probably damaging Het
Cecr2 A T 6: 120,733,894 (GRCm39) Q627L probably benign Het
Cerkl C A 2: 79,172,751 (GRCm39) M307I probably benign Het
Eif2ak4 A G 2: 118,293,207 (GRCm39) I1254M probably damaging Het
Epha3 T C 16: 63,664,510 (GRCm39) T37A probably benign Het
Fancm T C 12: 65,171,931 (GRCm39) V1857A probably damaging Het
Gm3486 T C 14: 41,206,538 (GRCm39) probably null Het
Il1r2 T C 1: 40,162,416 (GRCm39) V353A probably damaging Het
Irgq A T 7: 24,233,715 (GRCm39) R519W probably damaging Het
Map1b T A 13: 99,652,950 (GRCm39) S16C probably damaging Het
Myo9a T G 9: 59,739,573 (GRCm39) C762G probably damaging Het
Nup107 A T 10: 117,606,374 (GRCm39) V454E probably damaging Het
Or10h5 A G 17: 33,434,868 (GRCm39) V150A probably benign Het
Or4p20 A T 2: 88,254,228 (GRCm39) I47N probably damaging Het
Or7g35 T G 9: 19,496,265 (GRCm39) L144R probably damaging Het
Pcdha11 A G 18: 37,145,937 (GRCm39) K676R probably benign Het
Pknox2 C T 9: 36,834,986 (GRCm39) R161H probably damaging Het
Prr5l T C 2: 101,547,430 (GRCm39) N365S probably benign Het
Prrg4 A G 2: 104,679,501 (GRCm39) L8P probably damaging Het
Rasgrp2 T A 19: 6,453,595 (GRCm39) probably null Het
Rtp4 A T 16: 23,428,827 (GRCm39) H30L probably benign Het
Rxfp2 T G 5: 149,993,834 (GRCm39) I632S possibly damaging Het
Spata31h1 A C 10: 82,126,314 (GRCm39) F2232C probably damaging Het
Sptbn1 C A 11: 30,070,758 (GRCm39) E1533D possibly damaging Het
Ssbp1 A G 6: 40,454,941 (GRCm39) I133M probably damaging Het
Stap1 A G 5: 86,242,602 (GRCm39) I188V possibly damaging Het
Topaz1 T C 9: 122,603,173 (GRCm39) M1040T probably benign Het
Trpm3 T C 19: 22,887,501 (GRCm39) F877L possibly damaging Het
Ush1c A G 7: 45,858,674 (GRCm39) L538P probably damaging Het
Zfp518a G A 19: 40,904,162 (GRCm39) A1364T probably benign Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70,943,603 (GRCm39) missense probably benign 0.01
IGL01338:Adamts16 APN 13 70,984,234 (GRCm39) missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70,941,260 (GRCm39) missense probably benign 0.01
IGL01804:Adamts16 APN 13 70,949,080 (GRCm39) nonsense probably null
IGL01874:Adamts16 APN 13 70,916,823 (GRCm39) missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70,935,266 (GRCm39) missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70,921,048 (GRCm39) missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02357:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02429:Adamts16 APN 13 70,935,289 (GRCm39) splice site probably benign
IGL02450:Adamts16 APN 13 70,984,419 (GRCm39) missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70,886,897 (GRCm39) critical splice donor site probably null
IGL03356:Adamts16 APN 13 70,901,410 (GRCm39) missense probably benign 0.00
swap UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
switcheroo UTSW 13 70,949,073 (GRCm39) missense probably benign
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0201:Adamts16 UTSW 13 70,927,763 (GRCm39) missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70,927,730 (GRCm39) missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70,927,671 (GRCm39) missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70,887,074 (GRCm39) missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70,916,766 (GRCm39) missense probably benign
R0524:Adamts16 UTSW 13 70,949,013 (GRCm39) missense probably benign 0.00
R0590:Adamts16 UTSW 13 70,949,073 (GRCm39) missense probably benign
R0734:Adamts16 UTSW 13 70,886,600 (GRCm39) splice site probably benign
R0787:Adamts16 UTSW 13 70,886,948 (GRCm39) missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70,916,811 (GRCm39) missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70,911,680 (GRCm39) splice site probably benign
R1027:Adamts16 UTSW 13 70,915,921 (GRCm39) missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1535:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably null
R1617:Adamts16 UTSW 13 70,946,154 (GRCm39) missense probably benign 0.09
R1700:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70,927,717 (GRCm39) splice site probably null
R1869:Adamts16 UTSW 13 70,883,866 (GRCm39) missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70,940,005 (GRCm39) missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70,901,386 (GRCm39) missense probably benign 0.39
R2018:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70,949,126 (GRCm39) missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3411:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3842:Adamts16 UTSW 13 70,887,010 (GRCm39) missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70,916,111 (GRCm39) missense probably benign 0.01
R4435:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70,927,743 (GRCm39) missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70,901,315 (GRCm39) nonsense probably null
R5464:Adamts16 UTSW 13 70,909,868 (GRCm39) missense probably benign 0.01
R5613:Adamts16 UTSW 13 70,878,253 (GRCm39) missense probably benign 0.01
R5667:Adamts16 UTSW 13 70,984,494 (GRCm39) nonsense probably null
R5735:Adamts16 UTSW 13 70,984,337 (GRCm39) missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70,886,617 (GRCm39) missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70,877,029 (GRCm39) missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70,918,393 (GRCm39) nonsense probably null
R6351:Adamts16 UTSW 13 70,984,322 (GRCm39) missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70,927,689 (GRCm39) missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70,877,017 (GRCm39) missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70,916,639 (GRCm39) splice site probably null
R6996:Adamts16 UTSW 13 70,946,157 (GRCm39) critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70,921,074 (GRCm39) nonsense probably null
R7356:Adamts16 UTSW 13 70,984,399 (GRCm39) missense probably benign 0.03
R7509:Adamts16 UTSW 13 70,935,283 (GRCm39) missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70,878,234 (GRCm39) missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70,984,265 (GRCm39) missense probably damaging 0.97
R7968:Adamts16 UTSW 13 70,886,701 (GRCm39) missense probably benign
R8231:Adamts16 UTSW 13 70,925,599 (GRCm39) missense probably damaging 0.99
R8232:Adamts16 UTSW 13 70,941,217 (GRCm39) missense probably damaging 1.00
R8485:Adamts16 UTSW 13 70,886,794 (GRCm39) missense possibly damaging 0.89
R8772:Adamts16 UTSW 13 70,984,453 (GRCm39) missense probably damaging 1.00
R8916:Adamts16 UTSW 13 70,941,307 (GRCm39) missense probably damaging 1.00
R8921:Adamts16 UTSW 13 70,939,910 (GRCm39) splice site probably benign
R8973:Adamts16 UTSW 13 70,886,959 (GRCm39) missense probably benign 0.00
R9132:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9149:Adamts16 UTSW 13 70,883,948 (GRCm39) missense probably damaging 1.00
R9159:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9312:Adamts16 UTSW 13 70,949,045 (GRCm39) missense probably damaging 1.00
R9584:Adamts16 UTSW 13 70,949,136 (GRCm39) missense probably damaging 1.00
Z1176:Adamts16 UTSW 13 70,909,892 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTGCTGGCAGCTTTGAG -3'
(R):5'- CCAGTCTCAAATTCACGTGGAG -3'

Sequencing Primer
(F):5'- CTGGCAGCTTTGAGGTCGAG -3'
(R):5'- GCTGTCATGTGTACTCAC -3'
Posted On 2021-01-18