Mutagenetix > Incidental Mutation

Incidental Mutation 'R5907:Adamts16'

460738

Institutional Source

Beutler Lab

Gene Symbol

Adamts16

Ensembl Gene

ENSMUSG00000049538

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16

Synonyms

MMRRC Submission

044104-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5907 (G1)

Quality Score

118

Status

Validated

Chromosome

Chromosomal Location

70727802-70841811 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 70728910 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 1204 (C1204F)

Ref Sequence

ENSEMBL: ENSMUSP00000079041 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]

AlphaFold

Q69Z28

Predicted Effect

probably damaging
Transcript: ENSMUST00000080145
AA Change: C1204F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: C1204F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	57	203	7.8e-34	PFAM
Pfam:Reprolysin_5	287	470	2.9e-13	PFAM
Pfam:Reprolysin_4	289	489	1.2e-8	PFAM
Pfam:Reprolysin	289	493	5.4e-32	PFAM
Pfam:Reprolysin_2	306	483	3.7e-10	PFAM
Pfam:Reprolysin_3	310	442	6.4e-11	PFAM
TSP1	587	639	1.43e-14	SMART
Pfam:ADAM_spacer1	744	856	1.3e-37	PFAM
TSP1	872	926	3.48e0	SMART
TSP1	928	985	4.84e-3	SMART
TSP1	987	1046	1.49e-3	SMART
TSP1	1052	1113	3.19e-2	SMART
TSP1	1127	1179	7.68e-6	SMART
Pfam:PLAC	1188	1218	2.9e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123552

SMART Domains

Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	36	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	203	5.9e-33	PFAM
Pfam:Reprolysin_5	287	470	5.1e-14	PFAM
Pfam:Reprolysin_4	289	489	2.2e-9	PFAM
Pfam:Reprolysin	289	493	1.2e-33	PFAM
Pfam:Reprolysin_2	306	483	1.2e-10	PFAM
Pfam:Reprolysin_3	310	442	9.7e-11	PFAM
TSP1	587	639	1.43e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222750

Meta Mutation Damage Score

0.9495

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.7%

Validation Efficiency

93% (92/99)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	G	T	17: 33,066,150	D559E	probably benign	Het
4931429L15Rik	A	T	9: 46,306,822	I206N	probably damaging	Het
Aadac	T	A	3: 60,039,827	D315E	probably damaging	Het
Abcc8	A	G	7: 46,123,906	F800L	probably benign	Het
Adcy7	A	G	8: 88,312,228	T291A	possibly damaging	Het
AI182371	G	T	2: 35,086,122	Q255K	possibly damaging	Het
Aig1	A	T	10: 13,801,784		probably benign	Het
Ak5	T	C	3: 152,615,952	D266G	probably damaging	Het
Ank1	A	T	8: 23,140,204	E93D	probably damaging	Het
Bop1	T	C	15: 76,455,917	D153G	probably damaging	Het
Bub1	G	T	2: 127,819,222	N316K	probably benign	Het
Capn1	T	C	19: 5,997,797	N412S	probably benign	Het
Cdca4	A	G	12: 112,821,719	S130P	probably benign	Het
Cdh23	A	T	10: 60,428,379	D663E	probably damaging	Het
Clca3a1	T	C	3: 144,749,642		probably benign	Het
Csmd2	C	T	4: 128,197,385	P239L	probably damaging	Het
Dlg2	A	T	7: 91,997,371		probably benign	Het
Dnpep	C	T	1: 75,311,991		probably null	Het
Dopey2	A	T	16: 93,801,581	H1878L	probably damaging	Het
Dscam	C	T	16: 96,820,920	D444N	probably damaging	Het
Emc9	C	T	14: 55,582,112		probably null	Het
Ero1lb	T	A	13: 12,600,318	I346N	probably damaging	Het
Etv3	A	G	3: 87,535,543	T145A	probably benign	Het
Fam170a	T	A	18: 50,282,254		probably null	Het
Fap	A	T	2: 62,544,356	I261N	probably damaging	Het
Fbn2	T	C	18: 58,045,337	N1943S	probably damaging	Het
Glb1l3	A	T	9: 26,826,383	V466E	probably damaging	Het
Gm10521	A	T	1: 171,896,503	H127L	unknown	Het
Gm8186	G	T	17: 26,099,156	N22K	probably damaging	Het
Gpr132	A	C	12: 112,852,097	L370V	probably benign	Het
Hectd1	A	T	12: 51,798,754	H449Q	probably damaging	Het
Hook3	A	G	8: 26,044,278		probably benign	Het
Ift140	A	G	17: 25,092,371	D1180G	probably benign	Het
Isoc2b	A	T	7: 4,849,578		probably null	Het
Itga4	C	T	2: 79,322,656	H896Y	probably benign	Het
Itga7	T	C	10: 128,942,981	Y326H	probably damaging	Het
Itpr3	A	T	17: 27,117,893	E2397V	probably damaging	Het
Jtb	T	G	3: 90,235,577		probably null	Het
Klk15	A	G	7: 43,938,759	T164A	probably benign	Het
Kmt2e	C	A	5: 23,464,706	H64N	probably damaging	Het
Lamtor3	T	A	3: 137,927,293		probably benign	Het
Laptm4b	A	G	15: 34,258,684	I35V	possibly damaging	Het
Lrrc1	A	C	9: 77,434,097	L393R	probably damaging	Het
Ltn1	A	G	16: 87,381,503	S1613P	possibly damaging	Het
Mtmr4	T	A	11: 87,612,050	W920R	probably damaging	Het
Nbeal1	T	C	1: 60,228,791		probably benign	Het
Nup133	A	G	8: 123,916,299	Y761H	possibly damaging	Het
Nwd2	T	A	5: 63,805,983	V970D	probably damaging	Het
Olfr1058	A	T	2: 86,385,874	S181R	probably damaging	Het
Olfr1261	A	G	2: 89,993,957	H188R	probably benign	Het
Olfr429	T	C	1: 174,089,219	Y60H	probably benign	Het
Osbp	C	T	19: 11,973,876	L262F	probably damaging	Het
Phldb2	G	T	16: 45,825,188	D343E	probably damaging	Het
Phrf1	T	A	7: 141,260,540	M1216K	possibly damaging	Het
Phyh	A	T	2: 4,930,651		probably null	Het
Plekhf1	A	T	7: 38,222,170		probably null	Het
Rars	T	C	11: 35,828,648	N116D	probably damaging	Het
Rnf44	T	A	13: 54,682,808	Q181L	possibly damaging	Het
Rpe65	T	C	3: 159,615,682		probably null	Het
Scaf1	A	G	7: 45,013,592		probably benign	Het
Serpinb11	A	T	1: 107,372,189	R88S	probably benign	Het
Slc7a7	T	C	14: 54,379,103	N174S	probably damaging	Het
Slc9a5	T	C	8: 105,357,175		probably null	Het
Slfn1	C	A	11: 83,121,176	N39K	possibly damaging	Het
Snx20	G	A	8: 88,627,295	A269V	possibly damaging	Het
Snx6	A	G	12: 54,754,319	Y298H	probably damaging	Het
Stk32c	C	T	7: 139,120,674	R213Q	probably benign	Het
Tgfbr1	A	T	4: 47,396,555	I190F	probably damaging	Het
Ube2d2b	T	A	5: 107,830,632	F50I	probably damaging	Het
Ubl5	G	A	9: 20,646,534		probably benign	Het
Ubqln5	T	G	7: 104,128,574	T348P	possibly damaging	Het
Usp46	T	C	5: 74,037,085	D22G	probably benign	Het
Vars	A	G	17: 35,012,376	N655S	probably damaging	Het
Vmn2r103	A	C	17: 19,812,453	I830L	possibly damaging	Het
Vmn2r26	T	A	6: 124,039,871	N431K	probably benign	Het
Vmn2r4	G	T	3: 64,391,066	P547Q	probably damaging	Het
Yy1	T	A	12: 108,806,428		probably benign	Het
Zbtb2	A	T	10: 4,368,592	L478Q	possibly damaging	Het
Zfp12	T	C	5: 143,239,988	F17S	probably damaging	Het
Zfp219	T	A	14: 52,007,149		probably null	Het
Zfp629	G	A	7: 127,610,370	H756Y	probably damaging	Het
Zfp748	T	C	13: 67,541,173	K656R	possibly damaging	Het
Zfp958	T	A	8: 4,629,072	Y366N	probably benign	Het
Zp3	C	T	5: 135,988,523	T396I	probably benign	Het

Other mutations in Adamts16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Adamts16	APN	13	70795484	missense	probably benign	0.01
IGL01338:Adamts16	APN	13	70836115	missense	probably damaging	1.00
IGL01663:Adamts16	APN	13	70793141	missense	probably benign	0.01
IGL01804:Adamts16	APN	13	70800961	nonsense	probably null
IGL01874:Adamts16	APN	13	70768704	missense	possibly damaging	0.79
IGL01984:Adamts16	APN	13	70787147	missense	probably damaging	1.00
IGL02305:Adamts16	APN	13	70772929	missense	probably damaging	1.00
IGL02350:Adamts16	APN	13	70738585	missense	probably benign	0.00
IGL02357:Adamts16	APN	13	70738585	missense	probably benign	0.00
IGL02429:Adamts16	APN	13	70787170	splice site	probably benign
IGL02450:Adamts16	APN	13	70836300	missense	probably damaging	0.97
IGL02807:Adamts16	APN	13	70738778	critical splice donor site	probably null
IGL03356:Adamts16	APN	13	70753291	missense	probably benign	0.00
swap	UTSW	13	70779518	critical splice donor site	probably benign
switcheroo	UTSW	13	70800954	missense	probably benign
R0046:Adamts16	UTSW	13	70763460	missense	probably benign	0.00
R0046:Adamts16	UTSW	13	70763460	missense	probably benign	0.00
R0201:Adamts16	UTSW	13	70779644	missense	possibly damaging	0.69
R0326:Adamts16	UTSW	13	70779611	missense	possibly damaging	0.89
R0336:Adamts16	UTSW	13	70791794	critical splice donor site	probably benign
R0369:Adamts16	UTSW	13	70779552	missense	possibly damaging	0.94
R0422:Adamts16	UTSW	13	70738955	missense	probably damaging	1.00
R0507:Adamts16	UTSW	13	70768647	missense	probably benign
R0524:Adamts16	UTSW	13	70800894	missense	probably benign	0.00
R0590:Adamts16	UTSW	13	70800954	missense	probably benign
R0734:Adamts16	UTSW	13	70738481	splice site	probably benign
R0787:Adamts16	UTSW	13	70738829	missense	probably damaging	1.00
R0826:Adamts16	UTSW	13	70768692	missense	possibly damaging	0.64
R0920:Adamts16	UTSW	13	70763561	splice site	probably benign
R1027:Adamts16	UTSW	13	70767802	missense	probably damaging	1.00
R1462:Adamts16	UTSW	13	70836134	missense	probably benign	0.00
R1462:Adamts16	UTSW	13	70836134	missense	probably benign	0.00
R1535:Adamts16	UTSW	13	70791794	critical splice donor site	probably null
R1617:Adamts16	UTSW	13	70798035	missense	probably benign	0.09
R1700:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1734:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1736:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1737:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1738:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R1746:Adamts16	UTSW	13	70779598	splice site	probably null
R1869:Adamts16	UTSW	13	70735747	missense	probably damaging	1.00
R1944:Adamts16	UTSW	13	70791886	missense	possibly damaging	0.93
R1997:Adamts16	UTSW	13	70753267	missense	probably benign	0.39
R2018:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R2135:Adamts16	UTSW	13	70801007	missense	probably damaging	1.00
R2219:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R2228:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R3410:Adamts16	UTSW	13	70753226	missense	probably benign	0.00
R3411:Adamts16	UTSW	13	70753226	missense	probably benign	0.00
R3842:Adamts16	UTSW	13	70738891	missense	possibly damaging	0.92
R4117:Adamts16	UTSW	13	70767992	missense	probably benign	0.01
R4435:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4436:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4526:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4552:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4555:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4556:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4557:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4579:Adamts16	UTSW	13	70779624	missense	probably damaging	1.00
R4639:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4640:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4641:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4642:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R4672:Adamts16	UTSW	13	70779518	critical splice donor site	probably benign
R5350:Adamts16	UTSW	13	70753196	nonsense	probably null
R5464:Adamts16	UTSW	13	70761749	missense	probably benign	0.01
R5613:Adamts16	UTSW	13	70730134	missense	probably benign	0.01
R5667:Adamts16	UTSW	13	70836375	nonsense	probably null
R5735:Adamts16	UTSW	13	70836218	missense	possibly damaging	0.94
R5762:Adamts16	UTSW	13	70738498	missense	probably damaging	1.00
R6169:Adamts16	UTSW	13	70770274	nonsense	probably null
R6351:Adamts16	UTSW	13	70836203	missense	probably damaging	1.00
R6665:Adamts16	UTSW	13	70779570	missense	probably damaging	1.00
R6913:Adamts16	UTSW	13	70728898	missense	possibly damaging	0.94
R6982:Adamts16	UTSW	13	70768520	splice site	probably null
R6996:Adamts16	UTSW	13	70798038	critical splice acceptor site	probably null
R7313:Adamts16	UTSW	13	70772955	nonsense	probably null
R7356:Adamts16	UTSW	13	70836280	missense	probably benign	0.03
R7509:Adamts16	UTSW	13	70787164	missense	probably damaging	1.00
R7595:Adamts16	UTSW	13	70730115	missense	probably damaging	1.00
R7782:Adamts16	UTSW	13	70836146	missense	probably damaging	0.97
R7968:Adamts16	UTSW	13	70738582	missense	probably benign
R8231:Adamts16	UTSW	13	70777480	missense	probably damaging	0.99
R8232:Adamts16	UTSW	13	70793098	missense	probably damaging	1.00
R8470:Adamts16	UTSW	13	70836377	missense	probably damaging	1.00
R8485:Adamts16	UTSW	13	70738675	missense	possibly damaging	0.89
R8772:Adamts16	UTSW	13	70836334	missense	probably damaging	1.00
R8916:Adamts16	UTSW	13	70793188	missense	probably damaging	1.00
R8921:Adamts16	UTSW	13	70791791	splice site	probably benign
R8973:Adamts16	UTSW	13	70738840	missense	probably benign	0.00
R9132:Adamts16	UTSW	13	70753289	missense	probably benign	0.39
R9149:Adamts16	UTSW	13	70735829	missense	probably damaging	1.00
R9159:Adamts16	UTSW	13	70753289	missense	probably benign	0.39
R9312:Adamts16	UTSW	13	70800926	missense	probably damaging	1.00
R9584:Adamts16	UTSW	13	70801017	missense	probably damaging	1.00
Z1176:Adamts16	UTSW	13	70761773	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGATCCACTCTAGGTCAAAAGACC -3'
(R):5'- CAAGGCCCCTTTAACAGCTC -3'

Sequencing Primer
(F):5'- TCTAGGTCAAAAGACCCACAGTC -3'
(R):5'- AGCCTCAAGACCCACATTTTCTAGTG -3'

Posted On

2017-02-28