Incidental Mutation 'R0422:Adamts16'
ID37146
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 16
Synonyms
MMRRC Submission 038624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0422 (G1)
Quality Score200
Status Not validated
Chromosome13
Chromosomal Location70727802-70841811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70738955 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 937 (C937R)
Ref Sequence ENSEMBL: ENSMUSP00000079041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]
Predicted Effect probably damaging
Transcript: ENSMUST00000080145
AA Change: C937R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: C937R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123552
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,199 S511P possibly damaging Het
Acsm3 T A 7: 119,773,740 Y155* probably null Het
Akna T C 4: 63,392,154 D451G probably damaging Het
Alox12 A T 11: 70,254,558 V63E probably damaging Het
Ap3b1 T C 13: 94,462,460 I514T probably damaging Het
Arhgap23 T C 11: 97,463,652 M286T probably damaging Het
Cdkl2 T C 5: 92,020,312 D341G probably benign Het
Clip2 T C 5: 134,498,113 D813G probably benign Het
Cntnap3 A G 13: 64,757,285 V894A probably damaging Het
Coro2b T A 9: 62,427,977 Y304F probably benign Het
Dclre1a T A 19: 56,544,135 K676* probably null Het
Dmxl2 A G 9: 54,399,940 probably null Het
Dpep3 A G 8: 105,976,118 probably null Het
Efna5 C T 17: 62,607,419 A177T probably benign Het
Fabp1 G A 6: 71,203,093 V83I possibly damaging Het
H2-DMa G T 17: 34,137,947 G140C probably damaging Het
Hectd4 T A 5: 121,343,082 probably null Het
Hyou1 T A 9: 44,389,242 N869K probably damaging Het
Ing1 G A 8: 11,561,933 V124I probably damaging Het
Kalrn T A 16: 34,314,273 I380F probably damaging Het
Kcnh1 A G 1: 192,337,580 I378V probably benign Het
Kmt2c A G 5: 25,315,664 V1816A probably benign Het
Matn2 G A 15: 34,435,771 probably null Het
Naip2 C T 13: 100,161,113 S805N probably benign Het
Napsa A C 7: 44,585,106 Q254P probably damaging Het
Nat10 G T 2: 103,726,729 S860* probably null Het
Nipbl T C 15: 8,351,628 D560G probably benign Het
Nr3c2 A G 8: 77,185,967 M736V probably benign Het
Olfr1294 A T 2: 111,537,983 F102Y probably damaging Het
Olfr52 A T 2: 86,181,222 D296E probably benign Het
Olfr868 A T 9: 20,101,448 R230* probably null Het
Palm3 A G 8: 84,028,863 S335G possibly damaging Het
Panx1 G T 9: 15,007,816 S249* probably null Het
Parvb A G 15: 84,295,611 T231A probably benign Het
Pcdhb11 G T 18: 37,421,870 L84F probably damaging Het
Pi4k2b T C 5: 52,767,754 *447Q probably null Het
Ppp1r1a A G 15: 103,532,356 S125P probably benign Het
Prss1 T A 6: 41,463,312 D194E probably damaging Het
Rnf216 A T 5: 143,015,654 C772* probably null Het
Rnf216 A T 5: 143,090,370 F253Y probably benign Het
Rsf1 A T 7: 97,680,817 E1183D probably benign Het
Rusc1 T C 3: 89,086,825 T958A probably benign Het
Rxfp1 A G 3: 79,650,731 M480T probably benign Het
Slc22a16 T A 10: 40,591,890 V473E probably damaging Het
Slc26a3 A G 12: 31,465,849 T583A possibly damaging Het
Slc7a15 T C 12: 8,534,400 T117A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Slitrk6 T A 14: 110,752,293 probably benign Het
Spata7 A G 12: 98,658,265 Y110C probably damaging Het
Supt16 T A 14: 52,183,996 I31F probably benign Het
Taar7a T C 10: 23,993,274 T70A probably benign Het
Top2a A G 11: 99,009,853 F594L probably damaging Het
Unc13d C T 11: 116,070,020 probably null Het
Unc80 T G 1: 66,483,338 V233G probably damaging Het
Wdr91 A T 6: 34,880,846 D735E probably damaging Het
Zzef1 A G 11: 72,866,091 T1141A possibly damaging Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70795484 missense probably benign 0.01
IGL01338:Adamts16 APN 13 70836115 missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70793141 missense probably benign 0.01
IGL01804:Adamts16 APN 13 70800961 nonsense probably null
IGL01874:Adamts16 APN 13 70768704 missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70787147 missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70772929 missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02357:Adamts16 APN 13 70738585 missense probably benign 0.00
IGL02429:Adamts16 APN 13 70787170 splice site probably benign
IGL02450:Adamts16 APN 13 70836300 missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70738778 critical splice donor site probably null
IGL03356:Adamts16 APN 13 70753291 missense probably benign 0.00
swap UTSW 13 70779518 critical splice donor site probably benign
switcheroo UTSW 13 70800954 missense probably benign
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0046:Adamts16 UTSW 13 70763460 missense probably benign 0.00
R0201:Adamts16 UTSW 13 70779644 missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70779611 missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70791794 critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70779552 missense possibly damaging 0.94
R0507:Adamts16 UTSW 13 70768647 missense probably benign
R0524:Adamts16 UTSW 13 70800894 missense probably benign 0.00
R0590:Adamts16 UTSW 13 70800954 missense probably benign
R0734:Adamts16 UTSW 13 70738481 splice site probably benign
R0787:Adamts16 UTSW 13 70738829 missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70768692 missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70763561 splice site probably benign
R1027:Adamts16 UTSW 13 70767802 missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1462:Adamts16 UTSW 13 70836134 missense probably benign 0.00
R1535:Adamts16 UTSW 13 70791794 critical splice donor site probably null
R1617:Adamts16 UTSW 13 70798035 missense probably benign 0.09
R1700:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70779598 synonymous probably null
R1869:Adamts16 UTSW 13 70735747 missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70791886 missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70753267 missense probably benign 0.39
R2018:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70801007 missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3411:Adamts16 UTSW 13 70753226 missense probably benign 0.00
R3842:Adamts16 UTSW 13 70738891 missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70767992 missense probably benign 0.01
R4435:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70779624 missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70779518 critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70753196 nonsense probably null
R5464:Adamts16 UTSW 13 70761749 missense probably benign 0.01
R5613:Adamts16 UTSW 13 70730134 missense probably benign 0.01
R5667:Adamts16 UTSW 13 70836375 nonsense probably null
R5735:Adamts16 UTSW 13 70836218 missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70738498 missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70728910 missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70770274 nonsense probably null
R6351:Adamts16 UTSW 13 70836203 missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70779570 missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70728898 missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70768520 intron probably null
R6996:Adamts16 UTSW 13 70798038 critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70772955 nonsense probably null
R7356:Adamts16 UTSW 13 70836280 missense probably benign 0.03
R7509:Adamts16 UTSW 13 70787164 missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70730115 missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70836146 missense probably damaging 0.97
Z1176:Adamts16 UTSW 13 70761773 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCCTTGAGCACTGCATAAGAGAG -3'
(R):5'- AAAGCACTGCATTTGTGTCAGGTTG -3'

Sequencing Primer
(F):5'- CTTTCAGTGAAGGTGTTCCAC -3'
(R):5'- TGTCAGGTTGTCACTGGAAAAC -3'
Posted On2013-05-09