Incidental Mutation 'R8793:Btaf1'
ID 671071
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene Name B-TFIID TATA-box binding protein associated factor 1
Synonyms E430027O22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001080706
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R8793 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 36926079-37012752 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36981029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 649 (K649E)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
AlphaFold E9QAE3
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: K649E

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: K649E

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,383 D158A probably damaging Het
Acot7 G A 4: 152,199,923 V17I probably benign Het
Aes T C 10: 81,561,318 probably null Het
Akap13 A G 7: 75,725,328 T184A probably benign Het
Ankrd31 T A 13: 96,831,713 D619E probably damaging Het
Arap3 A G 18: 37,974,439 F1342L probably benign Het
Arfgef1 G C 1: 10,142,607 N1696K possibly damaging Het
Asap2 A G 12: 21,168,211 D45G probably damaging Het
Atp8b4 T A 2: 126,389,334 M456L probably benign Het
Bag5 A T 12: 111,710,921 I156N possibly damaging Het
Banp T A 8: 122,024,004 V478E probably benign Het
BC024063 A T 10: 82,109,518 H324L probably benign Het
Bms1 T A 6: 118,383,823 K1228M probably damaging Het
Cpox C A 16: 58,673,345 P226Q probably damaging Het
Cux1 A G 5: 136,565,685 S5P unknown Het
Dock2 G T 11: 34,501,215 Q837K probably benign Het
Fam171a1 T C 2: 3,186,498 I134T probably damaging Het
Gm13103 A G 4: 143,851,057 probably benign Het
Gm21119 G A 8: 20,619,037 V136I probably benign Het
Gm2832 A G 14: 41,281,769 T186A Het
Gm8246 T C 14: 5,476,822 E93G probably damaging Het
Grid2ip C T 5: 143,377,641 T463M probably damaging Het
Mael G A 1: 166,201,688 R389C probably benign Het
Myo9a C A 9: 59,884,567 Q1818K probably benign Het
Nwd1 A G 8: 72,693,076 D963G probably benign Het
Olfr123 T C 17: 37,796,364 S307P probably benign Het
Olfr273 A G 4: 52,856,490 F8L probably benign Het
Pappa2 A T 1: 158,851,161 V895E probably damaging Het
Pcna T C 2: 132,251,273 T185A probably benign Het
Pip4k2c A G 10: 127,206,661 F108L probably damaging Het
Pole T A 5: 110,297,748 S497T probably damaging Het
Ppp1r12c A G 7: 4,482,888 V653A probably benign Het
Ryr1 A T 7: 29,064,859 V3072E probably damaging Het
Sh3bgr G A 16: 96,224,592 probably null Het
Slc27a5 A C 7: 12,989,369 L550R probably benign Het
Strip2 C T 6: 29,956,816 P815S probably benign Het
Tarsl2 G T 7: 65,644,925 probably benign Het
Tmem237 G T 1: 59,107,454 L337M probably damaging Het
Ttn T C 2: 76,725,162 M30500V probably benign Het
Ube2u T C 4: 100,479,219 F13S probably damaging Het
Ugcg A C 4: 59,207,794 K44N probably benign Het
Vmn2r39 A T 7: 9,025,150 H407Q probably damaging Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
Galanos UTSW 19 36949102 missense probably damaging 1.00
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36945314 missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36958382 missense probably benign 0.02
R7402:Btaf1 UTSW 19 37003515 missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36969127 missense probably damaging 1.00
R7493:Btaf1 UTSW 19 37009605 missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36978403 missense probably benign 0.30
R7888:Btaf1 UTSW 19 36965636 missense probably benign 0.10
R7944:Btaf1 UTSW 19 36949165 missense probably benign
R8062:Btaf1 UTSW 19 36992465 missense probably benign 0.00
R8559:Btaf1 UTSW 19 36986873 missense probably benign 0.00
R8855:Btaf1 UTSW 19 36958501 missense probably benign
R8866:Btaf1 UTSW 19 36958501 missense probably benign
R9016:Btaf1 UTSW 19 36994305 missense probably benign 0.00
R9028:Btaf1 UTSW 19 36969108 missense probably damaging 1.00
R9109:Btaf1 UTSW 19 36986714 missense probably benign
R9172:Btaf1 UTSW 19 37000230 missense probably damaging 0.98
R9298:Btaf1 UTSW 19 36986714 missense probably benign
R9717:Btaf1 UTSW 19 36945246 missense probably benign 0.28
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCCTTCATTAACTTTAGTTAGGAA -3'
(R):5'- CTGACACACCCATGAAGAAATCTT -3'

Sequencing Primer
(F):5'- AGGAATTCTTCAGTCTCTGA -3'
(R):5'- CTGATACTTGGCACTTGG -3'
Posted On 2021-04-30