Incidental Mutation 'R8833:Pard3b'
ID673955
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Namepar-3 family cell polarity regulator beta
SynonymsPAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8833 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location61638824-62642284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62344999 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 841 (E841G)
Ref Sequence ENSEMBL: ENSMUSP00000074837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
PDB Structure Solution structure of PDZ domain in protein XP_110852 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000046673
AA Change: E779G

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: E779G

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075374
AA Change: E841G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: E841G

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094906
AA Change: E841G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: E841G

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik C T 14: 49,773,861 V130I probably benign Het
Akr1c6 T A 13: 4,446,378 D132E possibly damaging Het
Atp10b A G 11: 43,222,159 E844G probably damaging Het
Bbx T A 16: 50,225,266 M311L probably benign Het
Bzw2 A T 12: 36,119,070 M153K probably benign Het
C1qtnf6 G T 15: 78,525,374 T91K probably benign Het
Cdh4 A G 2: 179,894,035 D793G possibly damaging Het
Ces4a A G 8: 105,131,982 I11V probably benign Het
Cpne9 T C 6: 113,304,512 L518P probably damaging Het
Dip2c T A 13: 9,575,483 probably null Het
Fam129a T A 1: 151,644,930 V125E probably damaging Het
Fam135b T C 15: 71,462,934 N804D probably benign Het
Frem3 G A 8: 80,612,772 D565N probably benign Het
Fscb T A 12: 64,473,223 T490S unknown Het
Fuca1 A G 4: 135,920,895 D31G probably damaging Het
Gbp8 G T 5: 105,018,802 N220K possibly damaging Het
Gfra2 T C 14: 70,925,897 F207L probably damaging Het
Gm9495 A T 8: 69,429,330 D331E probably benign Het
Grap2 A G 15: 80,638,483 N70S probably benign Het
Ifna13 C A 4: 88,643,920 E156* probably null Het
Jmjd1c G A 10: 67,218,383 R22H probably benign Het
Macf1 A G 4: 123,471,341 V3209A probably benign Het
Muc5b A G 7: 141,858,368 T1684A unknown Het
Naip5 T A 13: 100,222,934 E598V probably damaging Het
Notch1 G A 2: 26,481,603 T278I probably damaging Het
Olfr1426 A G 19: 12,088,279 V171A possibly damaging Het
Olfr177 A T 16: 58,872,596 Y185N probably damaging Het
Olfr618 T G 7: 103,598,237 F307C possibly damaging Het
Olfr729 A T 14: 50,148,366 C169* probably null Het
Orm1 A T 4: 63,344,701 E35V probably damaging Het
Pak1 T A 7: 97,854,632 I58N possibly damaging Het
Pcdhb9 G T 18: 37,401,415 R154I probably benign Het
Pdpr G A 8: 111,125,680 V560I probably damaging Het
Pkdcc T C 17: 83,223,926 F455L probably damaging Het
Pus7l A T 15: 94,540,262 F234Y probably damaging Het
Rab3gap2 T A 1: 185,258,525 L632Q probably damaging Het
Rarb T A 14: 16,819,015 probably benign Het
Rom1 A T 19: 8,928,107 H236Q possibly damaging Het
Secisbp2 T C 13: 51,665,316 S311P probably benign Het
Slc26a1 T C 5: 108,672,316 D355G probably benign Het
Slc28a3 C T 13: 58,559,263 A574T probably damaging Het
Sox11 A G 12: 27,342,314 V32A possibly damaging Het
Spata17 T C 1: 187,183,239 Y107C probably damaging Het
Speer1 C A 5: 11,344,238 Y104* probably null Het
Stxbp5l T C 16: 37,204,452 T595A probably benign Het
Syt11 T C 3: 88,747,842 D78G probably damaging Het
Tatdn2 T G 6: 113,707,387 I674S probably damaging Het
Tex14 T A 11: 87,493,052 S189R probably benign Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Tor3a T C 1: 156,655,803 T350A probably benign Het
Trove2 T A 1: 143,765,779 K315* probably null Het
Ttr T G 18: 20,666,493 V36G probably damaging Het
Vmn1r129 A T 7: 21,361,280 H4Q probably null Het
Vmn1r32 A G 6: 66,553,639 M51T possibly damaging Het
Zfp141 T C 7: 42,476,263 T262A possibly damaging Het
Zfp980 T A 4: 145,701,026 N108K probably benign Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62161198 missense probably damaging 0.99
IGL01363:Pard3b APN 1 62637640 missense probably damaging 1.00
IGL01509:Pard3b APN 1 62161248 missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62637862 missense probably damaging 0.96
IGL01651:Pard3b APN 1 62479804 intron probably benign
IGL01670:Pard3b APN 1 62211648 missense probably damaging 1.00
IGL02156:Pard3b APN 1 61767950 missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62166382 missense probably damaging 1.00
IGL02450:Pard3b APN 1 62532676 missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62198771 splice site probably benign
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0060:Pard3b UTSW 1 61639315 missense probably damaging 0.97
R0157:Pard3b UTSW 1 62211633 missense probably damaging 0.96
R0333:Pard3b UTSW 1 62230212 missense probably benign 0.00
R0448:Pard3b UTSW 1 62166469 missense probably damaging 1.00
R0465:Pard3b UTSW 1 62211718 splice site probably benign
R0497:Pard3b UTSW 1 62440008 splice site probably null
R1264:Pard3b UTSW 1 62164157 missense probably damaging 1.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1482:Pard3b UTSW 1 62166367 missense probably damaging 1.00
R1554:Pard3b UTSW 1 62637894 missense probably damaging 0.97
R1836:Pard3b UTSW 1 62637604 missense probably benign 0.03
R2005:Pard3b UTSW 1 62144891 missense probably benign 0.12
R2220:Pard3b UTSW 1 62479683 nonsense probably null
R2435:Pard3b UTSW 1 62587738 missense probably damaging 1.00
R3015:Pard3b UTSW 1 62344878 missense probably damaging 1.00
R3688:Pard3b UTSW 1 62479569 missense probably benign
R3712:Pard3b UTSW 1 62343978 missense probably damaging 1.00
R3799:Pard3b UTSW 1 62161229 missense probably benign 0.06
R3942:Pard3b UTSW 1 62159452 missense probably damaging 1.00
R4683:Pard3b UTSW 1 62216516 missense probably benign
R4729:Pard3b UTSW 1 62211684 missense probably damaging 1.00
R4898:Pard3b UTSW 1 61768000 missense probably damaging 1.00
R4981:Pard3b UTSW 1 62344060 missense probably damaging 1.00
R5049:Pard3b UTSW 1 62161161 missense probably benign 0.01
R5223:Pard3b UTSW 1 62344113 missense probably damaging 1.00
R5476:Pard3b UTSW 1 62010406 missense probably benign 0.10
R5541:Pard3b UTSW 1 61639343 missense probably damaging 1.00
R5672:Pard3b UTSW 1 62010466 missense probably benign 0.11
R5714:Pard3b UTSW 1 62637916 missense probably null 0.99
R5722:Pard3b UTSW 1 62440001 splice site probably null
R5793:Pard3b UTSW 1 61767973 missense probably damaging 1.00
R5930:Pard3b UTSW 1 61768130 intron probably benign
R5950:Pard3b UTSW 1 62216531 missense probably benign 0.04
R5997:Pard3b UTSW 1 62076409 missense probably damaging 1.00
R6646:Pard3b UTSW 1 62161121 missense probably benign 0.32
R6720:Pard3b UTSW 1 62159470 missense probably damaging 0.99
R6809:Pard3b UTSW 1 62161181 missense probably damaging 1.00
R7148:Pard3b UTSW 1 62440032 missense probably benign 0.01
R7847:Pard3b UTSW 1 62343934 missense probably benign 0.00
R7879:Pard3b UTSW 1 62159511 missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62153989 missense probably damaging 1.00
R8125:Pard3b UTSW 1 61767984 missense probably damaging 1.00
R8329:Pard3b UTSW 1 62637798 missense probably benign 0.30
R8766:Pard3b UTSW 1 62159478 missense probably benign 0.35
R8889:Pard3b UTSW 1 62637867 missense probably damaging 0.97
R8892:Pard3b UTSW 1 62637867 missense probably damaging 0.97
R8907:Pard3b UTSW 1 62344135 missense probably benign 0.39
R8909:Pard3b UTSW 1 62344135 missense probably benign 0.39
Z1176:Pard3b UTSW 1 62238892 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTAGCCGTGTGGTTCAG -3'
(R):5'- TACACAATGGCGTGGTTTAGC -3'

Sequencing Primer
(F):5'- TATACTAGTGGTAAGTGCCCCTGAC -3'
(R):5'- TGGTTTAGCTAGGAGAAACAATGCC -3'
Posted On2021-07-15