Incidental Mutation 'R8859:Ankrd44'
ID 675495
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Name ankyrin repeat domain 44
Synonyms E130014H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R8859 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 54645340-54926387 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54667521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 592 (D592V)
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000178226] [ENSMUST00000179030]
AlphaFold B2RXR6
Predicted Effect probably damaging
Transcript: ENSMUST00000044359
AA Change: D610V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: D610V

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178226
AA Change: D407V

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136802
Gene: ENSMUSG00000052331
AA Change: D407V

DomainStartEndE-ValueType
ANK 2 31 1.1e-6 SMART
ANK 35 64 9.7e-8 SMART
ANK 68 98 1.11e-2 SMART
ANK 102 131 9.35e-1 SMART
ANK 135 164 2.02e-5 SMART
ANK 168 197 5.98e1 SMART
ANK 219 248 7.13e-6 SMART
ANK 252 281 1.18e-6 SMART
ANK 285 342 1.17e2 SMART
ANK 346 376 3.31e-1 SMART
ANK 381 410 3.91e-3 SMART
ANK 414 443 1.43e-5 SMART
ANK 448 477 2.73e-2 SMART
ANK 484 513 5.41e-6 SMART
ANK 517 546 5.53e-3 SMART
ANK 550 582 1.52e0 SMART
ANK 586 616 9.27e-5 SMART
ANK 618 648 1.52e0 SMART
ANK 653 682 6.02e-4 SMART
ANK 686 716 3.08e-1 SMART
ANK 720 752 3.36e-2 SMART
ANK 756 785 6.26e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179030
AA Change: D592V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: D592V

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 99% (95/96)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,378,397 Y3490F Het
Abcc1 T C 16: 14,396,361 V167A probably benign Het
Abcd2 G A 15: 91,188,946 R337C probably damaging Het
Adcy1 A G 11: 7,161,877 D914G probably benign Het
Ahnak G T 19: 9,007,203 L1950F probably damaging Het
Alox5ap T C 5: 149,265,184 probably null Het
Ank C T 15: 27,562,748 H181Y possibly damaging Het
Ap4m1 T A 5: 138,175,923 N185K possibly damaging Het
Arhgef28 T A 13: 97,945,702 D1199V probably damaging Het
Arnt T C 3: 95,490,380 probably null Het
Atcay C T 10: 81,224,464 V13M probably benign Het
B4galt3 T C 1: 171,271,671 S2P unknown Het
Bicra A T 7: 15,987,812 S593R possibly damaging Het
Brsk2 A C 7: 141,998,678 Q633P probably damaging Het
Cacna1c T A 6: 118,676,319 S909C Het
Ccdc7a G A 8: 129,061,632 T72M probably benign Het
Cct2 A T 10: 117,060,834 F155I possibly damaging Het
Cdv3 G T 9: 103,356,395 P194T probably damaging Het
Cenpc1 A T 5: 86,012,294 V895E probably benign Het
Cep170b T C 12: 112,736,447 V448A probably benign Het
Chil3 G A 3: 106,164,124 R75C possibly damaging Het
Cnfn A T 7: 25,368,444 C24S probably benign Het
Cnga3 A G 1: 37,260,771 K191E possibly damaging Het
Col12a1 A T 9: 79,680,399 Y1153* probably null Het
Coq4 C A 2: 29,795,479 H168Q probably damaging Het
Cyr61 T C 3: 145,648,625 D177G probably benign Het
Dnajc14 G A 10: 128,806,619 V137I probably benign Het
Efr3a T C 15: 65,854,765 L569P probably damaging Het
Epb41l3 A T 17: 69,284,580 E677D probably benign Het
Esp8 G A 17: 40,530,122 M91I unknown Het
Fubp1 A T 3: 152,232,032 probably benign Het
Gldc G T 19: 30,139,379 A391D probably damaging Het
Gm17728 A G 17: 9,422,195 T46A probably benign Het
Gm5798 A G 14: 41,350,646 K112E probably damaging Het
Gm884 A C 11: 103,615,544 I1866S unknown Het
Gpnmb A G 6: 49,052,030 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsdma3 C G 11: 98,631,260 A172G possibly damaging Het
Hltf C T 3: 20,065,402 Q204* probably null Het
Igf1r T G 7: 68,183,463 V457G possibly damaging Het
Inhbc A T 10: 127,357,115 M344K probably damaging Het
Jak3 C T 8: 71,678,516 A60V probably benign Het
Kif13b A G 14: 64,742,433 T511A probably benign Het
Lama2 T A 10: 27,459,388 N97I possibly damaging Het
Limd2 T A 11: 106,158,750 D104V probably damaging Het
Loxl3 T A 6: 83,037,545 C145S probably damaging Het
Lrrc73 A G 17: 46,254,529 N62S probably benign Het
Lrrtm4 A G 6: 80,021,887 D94G probably damaging Het
Lsm3 C A 6: 91,522,270 F86L probably damaging Het
Map10 T C 8: 125,670,552 V228A probably benign Het
Mcidas A C 13: 112,994,130 S54R possibly damaging Het
Me3 T C 7: 89,806,668 Y243H probably damaging Het
Mgat4b A G 11: 50,230,847 T89A possibly damaging Het
Mmp16 T A 4: 18,054,355 probably benign Het
Mtmr9 G A 14: 63,543,777 probably benign Het
Myo1b G T 1: 51,797,039 A331E probably damaging Het
Ncoa6 C T 2: 155,406,468 V1639M possibly damaging Het
Nek9 C T 12: 85,306,346 G752R probably damaging Het
Nufip2 A G 11: 77,693,243 Y661C probably benign Het
Olfr1490 T A 19: 13,654,882 V151E probably damaging Het
Olfr354 C T 2: 36,907,504 A186V possibly damaging Het
Olfr574 A T 7: 102,949,166 I234F probably damaging Het
Olfr828 T C 9: 18,815,696 I199M possibly damaging Het
Olfr972 G A 9: 39,873,598 G108S probably benign Het
Oxct2a A G 4: 123,322,529 L353S probably benign Het
Parvg A G 15: 84,337,800 I243V probably benign Het
Pcdhgb7 C A 18: 37,753,296 N506K possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pgghg G A 7: 140,945,454 probably null Het
Phrf1 G T 7: 141,256,603 G263W unknown Het
Ppfia1 A C 7: 144,479,025 probably null Het
Ppp1r32 T A 19: 10,482,235 Y36F probably damaging Het
Prss37 T A 6: 40,514,963 I228F probably damaging Het
Ptpro A T 6: 137,426,784 K921* probably null Het
Rictor T G 15: 6,783,586 L940R probably damaging Het
Rp1 A G 1: 4,349,960 S310P probably benign Het
Ryr3 A G 2: 112,653,219 V4091A probably damaging Het
Sirt5 T A 13: 43,370,851 M33K possibly damaging Het
Slc25a30 T A 14: 75,771,477 Y90F probably benign Het
St5 T A 7: 109,524,656 K1132M probably damaging Het
Stk11 G A 10: 80,128,435 D388N probably benign Het
Tgm1 C A 14: 55,712,229 R126L probably benign Het
Tmem110 T A 14: 30,866,672 Y119N probably damaging Het
Tmem129 G T 5: 33,654,493 T321N probably benign Het
Tnfrsf11a A T 1: 105,844,518 probably null Het
Tor1aip1 A G 1: 156,031,444 C195R probably benign Het
Tpr A G 1: 150,408,846 E428G possibly damaging Het
Trps1 T A 15: 50,822,373 D802V possibly damaging Het
Usp17lc T A 7: 103,415,109 S6T probably benign Het
Vangl1 C A 3: 102,158,442 R459L Het
Vmn1r43 T C 6: 89,869,955 Y183C probably damaging Het
Vmn2r110 C T 17: 20,574,298 C703Y probably damaging Het
Vmn2r54 T C 7: 12,629,775 Q397R possibly damaging Het
Vmn2r88 T C 14: 51,418,806 V824A probably damaging Het
Vmn2r89 A T 14: 51,455,713 Y79F probably benign Het
Vnn1 T C 10: 23,904,586 S491P probably benign Het
Zbbx A G 3: 75,061,434 F572L unknown Het
Zc3h4 A T 7: 16,435,014 Q1091L unknown Het
Zfp503 C T 14: 21,987,218 V106I possibly damaging Het
Zfp874a T C 13: 67,442,528 T346A probably benign Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7219:Ankrd44 UTSW 1 54766910 missense probably damaging 1.00
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
R7414:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R7490:Ankrd44 UTSW 1 54648300 missense probably benign 0.03
R7501:Ankrd44 UTSW 1 54649363 missense
R7515:Ankrd44 UTSW 1 54766355 missense probably damaging 1.00
R7527:Ankrd44 UTSW 1 54648324 missense probably benign 0.08
R7807:Ankrd44 UTSW 1 54792476 missense probably damaging 1.00
R8164:Ankrd44 UTSW 1 54663979 missense probably damaging 1.00
R8247:Ankrd44 UTSW 1 54752943 missense probably damaging 1.00
R8408:Ankrd44 UTSW 1 54723098 missense probably benign 0.00
R8963:Ankrd44 UTSW 1 54762379 missense probably damaging 1.00
R8971:Ankrd44 UTSW 1 54653793 missense probably benign 0.01
R8987:Ankrd44 UTSW 1 54661190 nonsense probably null
R9354:Ankrd44 UTSW 1 54648279 makesense probably null
RF021:Ankrd44 UTSW 1 54778312 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTGTGAAGCCACCTTG -3'
(R):5'- CCAAGTGTTGTTACAAGGGGATC -3'

Sequencing Primer
(F):5'- GTGAAGCCACCTTGACACATTTTAC -3'
(R):5'- CAAGGGGATCTTTGGAGTTTGTGAC -3'
Posted On 2021-07-15