Incidental Mutation 'R8903:Slc7a14'
ID 678287
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock # R8903 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 31202858-31310378 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 31223446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 670 (L670Q)
Ref Sequence ENSEMBL: ENSMUSP00000103880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
AlphaFold Q8BXR1
Predicted Effect probably benign
Transcript: ENSMUST00000091259
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108245
AA Change: L670Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: L670Q

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik C T 1: 87,475,104 T52I probably damaging Het
Abca14 T C 7: 120,216,303 F258S probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Ank2 A T 3: 127,046,782 N274K probably damaging Het
Ankrd31 C T 13: 96,832,821 L989F probably damaging Het
Ano6 A G 15: 95,927,582 R354G probably benign Het
Ano8 T C 8: 71,482,190 probably null Het
Arfgef1 T C 1: 10,141,613 Y1735C probably damaging Het
B3gnt8 G A 7: 25,629,234 G363D probably benign Het
Calcrl T C 2: 84,373,385 probably null Het
Cc2d2b A T 19: 40,809,282 D782V unknown Het
Ccdc162 A G 10: 41,655,444 probably null Het
Cdkal1 A T 13: 29,625,935 *219R probably null Het
Clcnkb A T 4: 141,407,849 V526D possibly damaging Het
Cnbp A T 6: 87,844,092 C162S probably damaging Het
Coq2 A G 5: 100,663,790 probably benign Het
D6Wsu163e T A 6: 126,954,815 L270Q probably damaging Het
Dnhd1 C T 7: 105,713,648 Q3806* probably null Het
Eepd1 T C 9: 25,483,222 F261L probably benign Het
Fam45a C T 19: 60,834,985 Q353* probably null Het
Fes C T 7: 80,386,811 probably benign Het
Fsip2 T A 2: 82,977,337 D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm5113 T C 7: 30,178,867 F127L probably benign Het
Grk3 A G 5: 112,918,831 S596P possibly damaging Het
Gsk3a A G 7: 25,237,389 V91A possibly damaging Het
Gss T C 2: 155,578,359 K141E probably damaging Het
Il1rl2 A T 1: 40,327,370 probably null Het
Kcnmb1 A G 11: 33,964,825 Y42C probably damaging Het
Krtap16-1 A T 11: 99,986,344 I78N probably damaging Het
Lrp2 C T 2: 69,549,038 S110N possibly damaging Het
Lrrfip1 T A 1: 91,085,059 probably benign Het
Magel2 G T 7: 62,379,693 A782S unknown Het
Map1b C A 13: 99,432,509 E1235* probably null Het
Mcpt1 A C 14: 56,020,063 H222P probably benign Het
Met T A 6: 17,549,138 N996K probably benign Het
Mia C A 7: 27,180,805 Q52H probably damaging Het
Mia T A 7: 27,180,806 Q52L possibly damaging Het
Myh7 T A 14: 54,992,771 K35* probably null Het
Myt1l T A 12: 29,811,469 D83E unknown Het
Nbl1 A G 4: 139,083,550 V111A probably damaging Het
Nid1 T A 13: 13,463,930 V145D probably benign Het
Nif3l1 C T 1: 58,447,494 probably benign Het
Npnt T C 3: 132,886,003 Y500C probably damaging Het
Nubpl T A 12: 52,097,893 probably null Het
Nxpe4 T A 9: 48,398,950 D504E probably damaging Het
Obsl1 A G 1: 75,487,273 V1696A possibly damaging Het
Olfr283 A T 15: 98,378,594 I172N probably damaging Het
Olfr679 A T 7: 105,086,122 R135S possibly damaging Het
P2rx1 A T 11: 73,009,995 H224L probably benign Het
Pald1 A T 10: 61,347,036 probably null Het
Pard6g C T 18: 80,117,196 R175* probably null Het
Pisd A G 5: 32,738,411 I271T probably benign Het
Prrt3 T C 6: 113,495,835 S459G probably damaging Het
Psd3 A T 8: 67,713,293 C328S unknown Het
Psme1 A G 14: 55,580,396 E120G Het
Pum3 A T 19: 27,420,057 M306K possibly damaging Het
Pxdn T C 12: 29,990,993 F423L probably benign Het
Rac3 A G 11: 120,723,245 D118G probably damaging Het
Rnf14 A G 18: 38,313,214 K357E probably benign Het
Rpl23a T C 11: 78,182,894 I40V probably benign Het
Slc5a5 A T 8: 70,892,583 S27T probably damaging Het
Sst T A 16: 23,889,749 K111* probably null Het
Stxbp4 A G 11: 90,535,441 S514P unknown Het
Susd1 T A 4: 59,390,576 T300S probably benign Het
Tecpr1 C T 5: 144,214,027 probably benign Het
Tmem185b C T 1: 119,526,468 probably benign Het
Tor2a T A 2: 32,761,687 F305I probably damaging Het
Ttk T A 9: 83,868,060 D689E probably damaging Het
Usp25 A G 16: 77,081,533 D615G probably damaging Het
Vmn1r209 A G 13: 22,806,514 V2A probably benign Het
Vmn2r80 A C 10: 79,182,094 E551A probably damaging Het
Wac G T 18: 7,926,104 E636* probably null Het
Wdr53 T A 16: 32,252,312 D158E probably damaging Het
Zbtb7c T C 18: 76,137,081 V80A probably damaging Het
Zcchc11 A T 4: 108,479,211 D44V probably damaging Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6020:Slc7a14 UTSW 3 31224112 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
R8227:Slc7a14 UTSW 3 31209212 missense probably benign 0.00
R8238:Slc7a14 UTSW 3 31227151 missense probably benign 0.01
R8524:Slc7a14 UTSW 3 31224133 missense possibly damaging 0.70
R8843:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R9011:Slc7a14 UTSW 3 31224196 missense probably damaging 1.00
R9208:Slc7a14 UTSW 3 31227210 missense probably damaging 1.00
R9633:Slc7a14 UTSW 3 31224017 missense probably benign 0.31
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATTCTCACACAAGAAGAGCTTTCAG -3'
(R):5'- TGTAATCCTGCAGCAGCCAG -3'

Sequencing Primer
(F):5'- AATGGATTGATAGGCATCGTTCTTCC -3'
(R):5'- TGCAGCAGCCAGAGAAC -3'
Posted On 2021-08-02