Mutagenetix > Incidental Mutation

Incidental Mutation 'R8903:Slc7a14'

678287

Institutional Source

Beutler Lab

Gene Symbol

Slc7a14

Ensembl Gene

ENSMUSG00000069072

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 14

Synonyms

MMRRC Submission

068760-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R8903 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31202858-31310378 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31223446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 670 (L670Q)

Ref Sequence

ENSEMBL: ENSMUSP00000103880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]

AlphaFold

Q8BXR1

Predicted Effect

probably benign
Transcript: ENSMUST00000091259

SMART Domains

Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	443	2.1e-44	PFAM
Pfam:AA_permease	57	436	7.2e-38	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	677	9.2e-21	PFAM
low complexity region	737	757	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108245
AA Change: L670Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: L670Q

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	53	445	2.5e-46	PFAM
Pfam:AA_permease	57	437	6.9e-41	PFAM
transmembrane domain	563	585	N/A	INTRINSIC
transmembrane domain	595	617	N/A	INTRINSIC
Pfam:AA_permease_C	627	668	1.4e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110079O15Rik	C	T	1: 87,475,104	T52I	probably damaging	Het
Abca14	T	C	7: 120,216,303	F258S	probably damaging	Het
Abca3	A	G	17: 24,383,985	Y518C	probably damaging	Het
Ank2	A	T	3: 127,046,782	N274K	probably damaging	Het
Ankrd31	C	T	13: 96,832,821	L989F	probably damaging	Het
Ano6	A	G	15: 95,927,582	R354G	probably benign	Het
Ano8	T	C	8: 71,482,190		probably null	Het
Arfgef1	T	C	1: 10,141,613	Y1735C	probably damaging	Het
B3gnt8	G	A	7: 25,629,234	G363D	probably benign	Het
Calcrl	T	C	2: 84,373,385		probably null	Het
Cc2d2b	A	T	19: 40,809,282	D782V	unknown	Het
Ccdc162	A	G	10: 41,655,444		probably null	Het
Cdkal1	A	T	13: 29,625,935	*219R	probably null	Het
Clcnkb	A	T	4: 141,407,849	V526D	possibly damaging	Het
Cnbp	A	T	6: 87,844,092	C162S	probably damaging	Het
Coq2	A	G	5: 100,663,790		probably benign	Het
D6Wsu163e	T	A	6: 126,954,815	L270Q	probably damaging	Het
Dnhd1	C	T	7: 105,713,648	Q3806*	probably null	Het
Eepd1	T	C	9: 25,483,222	F261L	probably benign	Het
Fam45a	C	T	19: 60,834,985	Q353*	probably null	Het
Fes	C	T	7: 80,386,811		probably benign	Het
Fsip2	T	A	2: 82,977,337	D1333E	possibly damaging	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm5113	T	C	7: 30,178,867	F127L	probably benign	Het
Grk3	A	G	5: 112,918,831	S596P	possibly damaging	Het
Gsk3a	A	G	7: 25,237,389	V91A	possibly damaging	Het
Gss	T	C	2: 155,578,359	K141E	probably damaging	Het
Il1rl2	A	T	1: 40,327,370		probably null	Het
Kcnmb1	A	G	11: 33,964,825	Y42C	probably damaging	Het
Krtap16-1	A	T	11: 99,986,344	I78N	probably damaging	Het
Lrp2	C	T	2: 69,549,038	S110N	possibly damaging	Het
Lrrfip1	T	A	1: 91,085,059		probably benign	Het
Magel2	G	T	7: 62,379,693	A782S	unknown	Het
Map1b	C	A	13: 99,432,509	E1235*	probably null	Het
Mcpt1	A	C	14: 56,020,063	H222P	probably benign	Het
Met	T	A	6: 17,549,138	N996K	probably benign	Het
Mia	C	A	7: 27,180,805	Q52H	probably damaging	Het
Mia	T	A	7: 27,180,806	Q52L	possibly damaging	Het
Myh7	T	A	14: 54,992,771	K35*	probably null	Het
Myt1l	T	A	12: 29,811,469	D83E	unknown	Het
Nbl1	A	G	4: 139,083,550	V111A	probably damaging	Het
Nid1	T	A	13: 13,463,930	V145D	probably benign	Het
Nif3l1	C	T	1: 58,447,494		probably benign	Het
Npnt	T	C	3: 132,886,003	Y500C	probably damaging	Het
Nubpl	T	A	12: 52,097,893		probably null	Het
Nxpe4	T	A	9: 48,398,950	D504E	probably damaging	Het
Obsl1	A	G	1: 75,487,273	V1696A	possibly damaging	Het
Olfr283	A	T	15: 98,378,594	I172N	probably damaging	Het
Olfr679	A	T	7: 105,086,122	R135S	possibly damaging	Het
P2rx1	A	T	11: 73,009,995	H224L	probably benign	Het
Pald1	A	T	10: 61,347,036		probably null	Het
Pard6g	C	T	18: 80,117,196	R175*	probably null	Het
Pisd	A	G	5: 32,738,411	I271T	probably benign	Het
Prrt3	T	C	6: 113,495,835	S459G	probably damaging	Het
Psd3	A	T	8: 67,713,293	C328S	unknown	Het
Psme1	A	G	14: 55,580,396	E120G		Het
Pum3	A	T	19: 27,420,057	M306K	possibly damaging	Het
Pxdn	T	C	12: 29,990,993	F423L	probably benign	Het
Rac3	A	G	11: 120,723,245	D118G	probably damaging	Het
Rnf14	A	G	18: 38,313,214	K357E	probably benign	Het
Rpl23a	T	C	11: 78,182,894	I40V	probably benign	Het
Slc5a5	A	T	8: 70,892,583	S27T	probably damaging	Het
Sst	T	A	16: 23,889,749	K111*	probably null	Het
Stxbp4	A	G	11: 90,535,441	S514P	unknown	Het
Susd1	T	A	4: 59,390,576	T300S	probably benign	Het
Tecpr1	C	T	5: 144,214,027		probably benign	Het
Tmem185b	C	T	1: 119,526,468		probably benign	Het
Tor2a	T	A	2: 32,761,687	F305I	probably damaging	Het
Ttk	T	A	9: 83,868,060	D689E	probably damaging	Het
Usp25	A	G	16: 77,081,533	D615G	probably damaging	Het
Vmn1r209	A	G	13: 22,806,514	V2A	probably benign	Het
Vmn2r80	A	C	10: 79,182,094	E551A	probably damaging	Het
Wac	G	T	18: 7,926,104	E636*	probably null	Het
Wdr53	T	A	16: 32,252,312	D158E	probably damaging	Het
Zbtb7c	T	C	18: 76,137,081	V80A	probably damaging	Het
Zcchc11	A	T	4: 108,479,211	D44V	probably damaging	Het

Other mutations in Slc7a14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02631:Slc7a14	APN	3	31238678	missense	probably damaging	1.00
IGL02713:Slc7a14	APN	3	31257763	missense	probably damaging	0.96
IGL03341:Slc7a14	APN	3	31238770	missense	probably damaging	1.00
IGL03350:Slc7a14	APN	3	31237409	missense	probably benign	0.35
IGL03379:Slc7a14	APN	3	31223515	missense	probably damaging	1.00
R0064:Slc7a14	UTSW	3	31227060	missense	probably damaging	1.00
R1549:Slc7a14	UTSW	3	31224118	missense	possibly damaging	0.94
R1591:Slc7a14	UTSW	3	31237449	missense	probably damaging	1.00
R2054:Slc7a14	UTSW	3	31237362	splice site	probably benign
R2057:Slc7a14	UTSW	3	31237496	missense	probably damaging	1.00
R2442:Slc7a14	UTSW	3	31230320	missense	probably damaging	1.00
R2504:Slc7a14	UTSW	3	31237501	missense	possibly damaging	0.85
R3848:Slc7a14	UTSW	3	31237474	missense	probably damaging	1.00
R4653:Slc7a14	UTSW	3	31257682	missense	probably damaging	1.00
R4702:Slc7a14	UTSW	3	31230398	missense	probably damaging	1.00
R5043:Slc7a14	UTSW	3	31237466	missense	probably damaging	1.00
R5187:Slc7a14	UTSW	3	31237365	splice site	probably null
R5345:Slc7a14	UTSW	3	31223857	missense	probably damaging	0.99
R5393:Slc7a14	UTSW	3	31257770	missense	probably damaging	1.00
R5421:Slc7a14	UTSW	3	31224197	missense	probably damaging	1.00
R5736:Slc7a14	UTSW	3	31223910	missense	probably benign	0.00
R5771:Slc7a14	UTSW	3	31238707	missense	probably damaging	1.00
R5896:Slc7a14	UTSW	3	31257570	missense	probably damaging	1.00
R5996:Slc7a14	UTSW	3	31209236	missense	probably benign
R6020:Slc7a14	UTSW	3	31224112	missense	probably benign
R6107:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R6140:Slc7a14	UTSW	3	31237548	missense	probably benign
R6491:Slc7a14	UTSW	3	31223944	missense	probably damaging	1.00
R6846:Slc7a14	UTSW	3	31224223	missense	probably damaging	1.00
R6990:Slc7a14	UTSW	3	31223579	missense	possibly damaging	0.90
R7184:Slc7a14	UTSW	3	31227063	missense	probably damaging	0.98
R7271:Slc7a14	UTSW	3	31224235	missense	probably damaging	1.00
R7282:Slc7a14	UTSW	3	31227153	missense	possibly damaging	0.67
R7331:Slc7a14	UTSW	3	31257731	missense	probably benign	0.00
R8227:Slc7a14	UTSW	3	31209212	missense	probably benign	0.00
R8238:Slc7a14	UTSW	3	31227151	missense	probably benign	0.01
R8524:Slc7a14	UTSW	3	31224133	missense	possibly damaging	0.70
R8843:Slc7a14	UTSW	3	31257610	missense	probably damaging	1.00
R9011:Slc7a14	UTSW	3	31224196	missense	probably damaging	1.00
R9208:Slc7a14	UTSW	3	31227210	missense	probably damaging	1.00
R9633:Slc7a14	UTSW	3	31224017	missense	probably benign	0.31
Z1088:Slc7a14	UTSW	3	31223999	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- ATTCTCACACAAGAAGAGCTTTCAG -3'
(R):5'- TGTAATCCTGCAGCAGCCAG -3'

Sequencing Primer
(F):5'- AATGGATTGATAGGCATCGTTCTTCC -3'
(R):5'- TGCAGCAGCCAGAGAAC -3'

Posted On

2021-08-02