Incidental Mutation 'R8933:Olfr552'
ID 680447
Institutional Source Beutler Lab
Gene Symbol Olfr552
Ensembl Gene ENSMUSG00000073973
Gene Name olfactory receptor 552
Synonyms GA_x6K02T2PBJ9-5323062-5324015, MOR28-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R8933 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102597770-102608125 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102604430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 25 (L25F)
Ref Sequence ENSEMBL: ENSMUSP00000150317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098223] [ENSMUST00000215712]
AlphaFold E9Q545
Predicted Effect probably damaging
Transcript: ENSMUST00000098223
AA Change: L25F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095826
Gene: ENSMUSG00000073973
AA Change: L25F

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 6e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 270 4.4e-8 PFAM
Pfam:7tm_1 43 294 9.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215712
AA Change: L25F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,128,137 I1114N probably damaging Het
Ache C A 5: 137,290,187 R52S possibly damaging Het
AI182371 A T 2: 35,085,702 probably null Het
Ankrd17 T C 5: 90,258,466 S1453G probably damaging Het
Arvcf A G 16: 18,400,095 N508S probably damaging Het
Aurkc A C 7: 7,002,797 D136A possibly damaging Het
Bfsp2 A G 9: 103,448,649 M265T probably benign Het
Bmpr1b T C 3: 141,856,608 T273A probably damaging Het
Cacnb1 T C 11: 98,005,752 K406R probably damaging Het
Calcoco2 C T 11: 96,107,426 probably benign Het
Capza1 T C 3: 104,840,893 probably null Het
Ccdc63 T A 5: 122,113,202 I382F probably damaging Het
Cep350 A T 1: 155,863,415 N2227K probably benign Het
Chia1 T A 3: 106,129,017 Y304* probably null Het
Col5a2 G A 1: 45,421,963 P258L Het
Cyp21a1 A G 17: 34,804,311 L30P probably damaging Het
Dennd4b T A 3: 90,279,216 H1351Q probably benign Het
Dnah9 T A 11: 65,855,252 I4012F possibly damaging Het
Drd1 A G 13: 54,053,271 I301T possibly damaging Het
Dzip1 T A 14: 118,906,914 H369L probably damaging Het
Fgfrl1 T A 5: 108,703,391 M58K probably damaging Het
Ftsj3 G T 11: 106,250,834 D529E probably benign Het
Fut9 A T 4: 25,619,861 W318R probably damaging Het
Gabrg3 A G 7: 56,984,958 I159T probably damaging Het
Gabrr1 A T 4: 33,146,972 D53V probably benign Het
Ggps1 A G 13: 14,054,343 V85A probably benign Het
Gm5141 C T 13: 62,777,040 W18* probably null Het
Grik5 T A 7: 25,023,318 T518S probably benign Het
Hapln3 A T 7: 79,117,630 probably benign Het
Hbs1l C T 10: 21,367,685 Q646* probably null Het
Hmox1 T C 8: 75,097,016 I104T probably benign Het
Ifit1bl1 T C 19: 34,594,013 Y348C probably damaging Het
Igf2r A T 17: 12,701,244 S1403T probably damaging Het
Igf2r G A 17: 12,704,637 T1186M probably damaging Het
Igfbp1 T C 11: 7,198,333 probably null Het
Ikbip C A 10: 91,083,230 A35E probably benign Het
Isca1 C T 13: 59,769,683 A8T probably damaging Het
Itgb2 T C 10: 77,565,188 L754P probably damaging Het
Itgb6 C T 2: 60,627,903 C502Y probably damaging Het
Kdm3a A G 6: 71,600,108 V741A probably benign Het
Kdsr T C 1: 106,753,219 D83G possibly damaging Het
Kiz T A 2: 146,942,117 N523K Het
Kmt2a T C 9: 44,822,505 probably benign Het
Krt25 T C 11: 99,321,238 E191G probably benign Het
Lipn A G 19: 34,069,480 I61V probably damaging Het
Lmbr1l T A 15: 98,909,269 probably null Het
Lrrc4c A G 2: 97,629,481 K151E probably benign Het
Mab21l3 T C 3: 101,823,458 Q155R probably benign Het
Mtfr2 G A 10: 20,357,528 R281H possibly damaging Het
Muc5ac A G 7: 141,789,756 Y35C possibly damaging Het
Myadm C T 7: 3,296,917 T65I probably benign Het
Nap1l1 T C 10: 111,492,849 V213A probably benign Het
Nav2 A G 7: 49,461,957 D737G probably damaging Het
Ndst4 T A 3: 125,611,506 V470D probably damaging Het
Nek5 T A 8: 22,111,210 Y165F probably damaging Het
Nek5 A T 8: 22,120,843 V48E probably damaging Het
Nr6a1 T C 2: 38,760,388 I77V probably damaging Het
Nvl A T 1: 181,139,073 D93E probably benign Het
Olfr450 A G 6: 42,818,016 T182A probably benign Het
Olfr656 A T 7: 104,617,666 T4S probably benign Het
Olfr678 A G 7: 105,069,392 probably benign Het
Olfr780 A T 10: 129,322,390 I256F probably damaging Het
Olfr96 C A 17: 37,225,455 T110K possibly damaging Het
Pla2g4c G A 7: 13,339,702 V225I probably benign Het
Plppr4 T A 3: 117,323,041 N331I probably damaging Het
Ptpn13 A G 5: 103,579,805 R2051G probably benign Het
Rbm45 T C 2: 76,378,724 S346P probably damaging Het
Samd14 A C 11: 95,021,201 D168A probably damaging Het
Slc15a1 C T 14: 121,486,679 G172R probably benign Het
Slco3a1 G T 7: 74,284,500 Y641* probably null Het
Srcap G A 7: 127,552,394 R2027H probably damaging Het
Stra8 A T 6: 34,927,689 probably benign Het
Syt11 T C 3: 88,747,704 Y430C probably damaging Het
Tanc1 T G 2: 59,785,456 V269G possibly damaging Het
Tead1 A G 7: 112,898,611 N342S probably benign Het
Tenm3 C T 8: 48,279,060 A1254T possibly damaging Het
Txlnb A T 10: 17,806,798 N156I probably damaging Het
Ufl1 A T 4: 25,262,258 S409R possibly damaging Het
Usp17la A G 7: 104,861,100 H304R probably benign Het
Vmn1r203 T A 13: 22,524,521 H157Q possibly damaging Het
Vmn1r37 C T 6: 66,732,247 R249* probably null Het
Vmn2r96 A G 17: 18,583,979 Q497R probably benign Het
Vps39 A G 2: 120,338,585 S292P probably benign Het
Wnk1 A G 6: 120,036,998 V212A probably damaging Het
Xbp1 T C 11: 5,524,741 V161A probably benign Het
Zfp113 T C 5: 138,144,830 Q386R probably damaging Het
Other mutations in Olfr552
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Olfr552 APN 7 102604357 start codon destroyed probably null 0.99
IGL03061:Olfr552 APN 7 102604739 missense probably damaging 0.99
R0989:Olfr552 UTSW 7 102604483 missense probably damaging 1.00
R1513:Olfr552 UTSW 7 102605302 missense probably benign 0.09
R1969:Olfr552 UTSW 7 102604570 missense probably damaging 0.99
R3177:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R3277:Olfr552 UTSW 7 102604576 missense possibly damaging 0.94
R4019:Olfr552 UTSW 7 102604642 missense probably damaging 1.00
R4028:Olfr552 UTSW 7 102605293 missense possibly damaging 0.62
R5216:Olfr552 UTSW 7 102604821 missense probably benign 0.00
R5444:Olfr552 UTSW 7 102604869 nonsense probably null
R5461:Olfr552 UTSW 7 102604408 missense probably damaging 0.99
R7706:Olfr552 UTSW 7 102604646 missense probably benign 0.12
R8348:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8448:Olfr552 UTSW 7 102605000 missense probably benign 0.01
R8919:Olfr552 UTSW 7 102604504 missense probably damaging 1.00
R9009:Olfr552 UTSW 7 102604435 missense probably benign 0.00
R9139:Olfr552 UTSW 7 102604978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAATAGGTGACTTTCTCTTGTG -3'
(R):5'- ACAGGGAGAGCATTTTGGGC -3'

Sequencing Primer
(F):5'- TATTTGAAGACTCACACAAGAGAAG -3'
(R):5'- AGAGCATTTTGGGCAGTGTTGAC -3'
Posted On 2021-08-31