Incidental Mutation 'R9002:Mroh8'
ID 685007
Institutional Source Beutler Lab
Gene Symbol Mroh8
Ensembl Gene ENSMUSG00000074627
Gene Name maestro heat-like repeat family member 8
Synonyms 4922505G16Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock # R9002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 157208550-157279549 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 157217019 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 909 (V909G)
Ref Sequence ENSEMBL: ENSMUSP00000124362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143663]
AlphaFold E9PYI4
Predicted Effect probably damaging
Transcript: ENSMUST00000143663
AA Change: V909G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124362
Gene: ENSMUSG00000074627
AA Change: V909G

DomainStartEndE-ValueType
low complexity region 189 200 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
SCOP:d1qbkb_ 724 1024 8e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the maestro heat-like repeat family. The exact function of this gene is not known, however, in a genome-wide association study using hippocampal atrophy as a quantitative trait, this gene has been associated with Alzheimer's disease (PMID:19668339). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,926 M1263K possibly damaging Het
Abca8b C T 11: 109,952,630 D985N probably benign Het
Ak5 A T 3: 152,653,454 M207K probably damaging Het
Akt1 T C 12: 112,659,614 I75V probably benign Het
Ank T A 15: 27,544,327 L58* probably null Het
Ap1g1 A C 8: 109,855,106 T666P probably benign Het
Ap3b2 A T 7: 81,467,444 S615T probably benign Het
Ash1l G T 3: 88,981,408 R198L probably benign Het
Axl A T 7: 25,778,678 C199S probably damaging Het
C1d T C 11: 17,262,787 L44S probably damaging Het
Chst13 G A 6: 90,309,524 P152L probably damaging Het
Col4a4 A G 1: 82,471,311 L1186P probably benign Het
Ctdsp2 T A 10: 126,996,192 I223N probably damaging Het
Eml1 T A 12: 108,538,179 I799N probably damaging Het
Fbxw18 G A 9: 109,690,592 T282I probably damaging Het
Fmo2 A T 1: 162,878,078 C397* probably null Het
Gbp10 C A 5: 105,221,981 V262L probably benign Het
Gm11639 A T 11: 105,029,996 D4671V probably damaging Het
Gm45871 A T 18: 90,591,844 H402L probably damaging Het
Has1 T C 17: 17,843,650 S576G unknown Het
Hat1 C T 2: 71,441,303 R407W probably damaging Het
Hivep2 G T 10: 14,132,413 R1585L probably benign Het
Ifi211 A G 1: 173,906,328 V89A possibly damaging Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Irf9 T A 14: 55,607,683 N333K possibly damaging Het
Jakmip2 C T 18: 43,582,258 V68I probably benign Het
Kif1b T G 4: 149,191,255 I1400L probably damaging Het
Kif2b C T 11: 91,576,227 C410Y probably benign Het
Klk1b16 T C 7: 44,140,765 L153P possibly damaging Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lama5 A G 2: 180,196,518 C855R probably damaging Het
Mast3 A G 8: 70,781,260 L947P probably damaging Het
Mblac2 C A 13: 81,711,953 A142E possibly damaging Het
Mppe1 A G 18: 67,225,854 S348P possibly damaging Het
Mthfd1 C T 12: 76,303,980 T712M probably benign Het
Nek10 T C 14: 14,980,590 L982P probably damaging Het
Nlrp4b C T 7: 10,714,959 T363I probably damaging Het
Nol10 A G 12: 17,358,133 E120G probably damaging Het
Olfml1 T C 7: 107,590,216 S163P probably damaging Het
Olfr1104 T C 2: 87,021,897 T216A probably benign Het
Olfr135 A T 17: 38,208,664 N140Y probably benign Het
Olfr522 T C 7: 140,162,285 I222V probably damaging Het
Olfr576 A T 7: 102,965,411 I104F probably damaging Het
Olfr902 T A 9: 38,448,875 M1K probably null Het
Pde6a T A 18: 61,285,989 L812Q probably damaging Het
Pdxp T A 15: 78,918,259 M231K probably damaging Het
Pi4ka A G 16: 17,299,453 L1368P Het
Ppie T C 4: 123,130,551 N171S possibly damaging Het
Rimbp2 T C 5: 128,788,292 H657R probably benign Het
Sarnp T A 10: 128,821,973 probably null Het
Serpinb9c T C 13: 33,150,346 T266A probably damaging Het
Srgap3 T A 6: 112,780,893 I218F possibly damaging Het
Susd1 C A 4: 59,324,882 W717L probably benign Het
Tgfbi A G 13: 56,623,589 Y88C probably damaging Het
Tmc6 A T 11: 117,770,482 F624Y probably damaging Het
Tnni2 A G 7: 142,444,276 E172G probably damaging Het
Traf3ip1 T C 1: 91,505,456 S316P probably benign Het
Tshr C A 12: 91,537,774 N495K possibly damaging Het
Ulk3 C A 9: 57,593,259 A317E probably damaging Het
Usp24 T C 4: 106,418,215 V2229A possibly damaging Het
Usp32 G A 11: 85,053,951 R304C probably damaging Het
Usp40 C T 1: 88,007,341 G28D probably benign Het
Vmn1r41 A G 6: 89,747,127 K217E possibly damaging Het
Vmn2r73 T A 7: 85,858,076 K676M probably benign Het
Vnn1 A G 10: 23,899,451 T200A possibly damaging Het
Zc3hav1 A G 6: 38,325,241 L698P possibly damaging Het
Other mutations in Mroh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mroh8 APN 2 157216914 missense probably damaging 1.00
IGL00691:Mroh8 APN 2 157238307 splice site probably benign
IGL00708:Mroh8 APN 2 157220170 missense probably damaging 1.00
IGL01526:Mroh8 APN 2 157238312 splice site probably benign
IGL01992:Mroh8 APN 2 157213696 missense probably damaging 1.00
IGL02076:Mroh8 APN 2 157271962 critical splice donor site probably null
IGL02308:Mroh8 APN 2 157254973 missense probably damaging 1.00
IGL02592:Mroh8 APN 2 157216969 missense probably damaging 0.96
PIT4378001:Mroh8 UTSW 2 157228700 missense possibly damaging 0.73
PIT4449001:Mroh8 UTSW 2 157225534 missense probably damaging 1.00
R0039:Mroh8 UTSW 2 157229929 missense possibly damaging 0.92
R0039:Mroh8 UTSW 2 157229929 missense possibly damaging 0.92
R0107:Mroh8 UTSW 2 157225468 missense probably benign 0.01
R0511:Mroh8 UTSW 2 157229918 missense probably damaging 1.00
R0523:Mroh8 UTSW 2 157224036 missense probably damaging 1.00
R0619:Mroh8 UTSW 2 157265081 missense possibly damaging 0.69
R1222:Mroh8 UTSW 2 157241854 splice site probably benign
R1418:Mroh8 UTSW 2 157241854 splice site probably benign
R1430:Mroh8 UTSW 2 157269525 missense possibly damaging 0.69
R1458:Mroh8 UTSW 2 157221304 missense probably damaging 1.00
R1509:Mroh8 UTSW 2 157233205 missense probably benign 0.14
R1528:Mroh8 UTSW 2 157230055 missense probably damaging 1.00
R1703:Mroh8 UTSW 2 157271976 missense probably benign 0.01
R1795:Mroh8 UTSW 2 157269551 missense probably benign 0.16
R1982:Mroh8 UTSW 2 157271975 missense possibly damaging 0.52
R3922:Mroh8 UTSW 2 157222811 missense probably benign 0.03
R4024:Mroh8 UTSW 2 157256352 missense probably benign 0.32
R4030:Mroh8 UTSW 2 157213720 missense probably damaging 1.00
R4200:Mroh8 UTSW 2 157241810 missense probably benign 0.10
R4492:Mroh8 UTSW 2 157258040 missense probably damaging 1.00
R4900:Mroh8 UTSW 2 157228727 missense probably benign 0.05
R5396:Mroh8 UTSW 2 157228656 missense possibly damaging 0.92
R5464:Mroh8 UTSW 2 157221230 missense probably damaging 1.00
R6008:Mroh8 UTSW 2 157253064 missense probably benign 0.40
R6220:Mroh8 UTSW 2 157233163 missense probably benign
R6661:Mroh8 UTSW 2 157225627 missense probably benign
R7000:Mroh8 UTSW 2 157216977 missense probably benign 0.03
R7024:Mroh8 UTSW 2 157221263 missense probably benign
R7221:Mroh8 UTSW 2 157229917 missense probably benign 0.06
R7549:Mroh8 UTSW 2 157269572 missense probably benign 0.01
R7593:Mroh8 UTSW 2 157229947 missense probably damaging 1.00
R7604:Mroh8 UTSW 2 157269564 missense possibly damaging 0.75
R8316:Mroh8 UTSW 2 157229959 missense possibly damaging 0.93
R8371:Mroh8 UTSW 2 157252976 nonsense probably null
R8795:Mroh8 UTSW 2 157225573 missense probably damaging 0.96
R8797:Mroh8 UTSW 2 157229956 missense probably damaging 1.00
R8801:Mroh8 UTSW 2 157233166 missense probably damaging 1.00
R8850:Mroh8 UTSW 2 157241753 missense probably damaging 1.00
R9021:Mroh8 UTSW 2 157222867 missense probably benign 0.06
R9110:Mroh8 UTSW 2 157213685 missense possibly damaging 0.82
R9189:Mroh8 UTSW 2 157269625 missense probably damaging 0.97
R9224:Mroh8 UTSW 2 157221149 missense possibly damaging 0.83
R9225:Mroh8 UTSW 2 157265090 missense probably damaging 0.99
R9387:Mroh8 UTSW 2 157256466 missense possibly damaging 0.75
R9453:Mroh8 UTSW 2 157230028 missense possibly damaging 0.55
R9485:Mroh8 UTSW 2 157229993 missense probably benign 0.34
R9652:Mroh8 UTSW 2 157253050 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCCATGTGTCTCAGCTAAAAG -3'
(R):5'- CATTGTGTTCACACCTTGCAGG -3'

Sequencing Primer
(F):5'- GCTAAAAGCTATCAGAAAAGCAAGC -3'
(R):5'- TCCTTCAGCGTCTTCAGGAGG -3'
Posted On 2021-10-11