Mutagenetix > Incidental Mutation

Incidental Mutation 'R9002:Abca8b'

685046

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9002 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 109952630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 985 (D985N)

Ref Sequence

ENSEMBL: ENSMUSP00000020948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

AlphaFold

Q8K440

Predicted Effect

probably benign
Transcript: ENSMUST00000020948
AA Change: D985N

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: D985N

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106669
AA Change: D923N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: D923N

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,291,926	M1263K	possibly damaging	Het
Ak5	A	T	3: 152,653,454	M207K	probably damaging	Het
Akt1	T	C	12: 112,659,614	I75V	probably benign	Het
Ank	T	A	15: 27,544,327	L58*	probably null	Het
Ap1g1	A	C	8: 109,855,106	T666P	probably benign	Het
Ap3b2	A	T	7: 81,467,444	S615T	probably benign	Het
Ash1l	G	T	3: 88,981,408	R198L	probably benign	Het
Axl	A	T	7: 25,778,678	C199S	probably damaging	Het
C1d	T	C	11: 17,262,787	L44S	probably damaging	Het
Chst13	G	A	6: 90,309,524	P152L	probably damaging	Het
Col4a4	A	G	1: 82,471,311	L1186P	probably benign	Het
Ctdsp2	T	A	10: 126,996,192	I223N	probably damaging	Het
Eml1	T	A	12: 108,538,179	I799N	probably damaging	Het
Fbxw18	G	A	9: 109,690,592	T282I	probably damaging	Het
Fmo2	A	T	1: 162,878,078	C397*	probably null	Het
Gbp10	C	A	5: 105,221,981	V262L	probably benign	Het
Gm11639	A	T	11: 105,029,996	D4671V	probably damaging	Het
Gm45871	A	T	18: 90,591,844	H402L	probably damaging	Het
Has1	T	C	17: 17,843,650	S576G	unknown	Het
Hat1	C	T	2: 71,441,303	R407W	probably damaging	Het
Hivep2	G	T	10: 14,132,413	R1585L	probably benign	Het
Ifi211	A	G	1: 173,906,328	V89A	possibly damaging	Het
Igkv4-59	T	C	6: 69,438,491	T27A	possibly damaging	Het
Irf9	T	A	14: 55,607,683	N333K	possibly damaging	Het
Jakmip2	C	T	18: 43,582,258	V68I	probably benign	Het
Kif1b	T	G	4: 149,191,255	I1400L	probably damaging	Het
Kif2b	C	T	11: 91,576,227	C410Y	probably benign	Het
Klk1b16	T	C	7: 44,140,765	L153P	possibly damaging	Het
Kndc1	C	T	7: 139,927,795	S1222F	possibly damaging	Het
Lama5	A	G	2: 180,196,518	C855R	probably damaging	Het
Mast3	A	G	8: 70,781,260	L947P	probably damaging	Het
Mblac2	C	A	13: 81,711,953	A142E	possibly damaging	Het
Mppe1	A	G	18: 67,225,854	S348P	possibly damaging	Het
Mroh8	A	C	2: 157,217,019	V909G	probably damaging	Het
Mthfd1	C	T	12: 76,303,980	T712M	probably benign	Het
Nek10	T	C	14: 14,980,590	L982P	probably damaging	Het
Nlrp4b	C	T	7: 10,714,959	T363I	probably damaging	Het
Nol10	A	G	12: 17,358,133	E120G	probably damaging	Het
Olfml1	T	C	7: 107,590,216	S163P	probably damaging	Het
Olfr1104	T	C	2: 87,021,897	T216A	probably benign	Het
Olfr135	A	T	17: 38,208,664	N140Y	probably benign	Het
Olfr522	T	C	7: 140,162,285	I222V	probably damaging	Het
Olfr576	A	T	7: 102,965,411	I104F	probably damaging	Het
Olfr902	T	A	9: 38,448,875	M1K	probably null	Het
Pde6a	T	A	18: 61,285,989	L812Q	probably damaging	Het
Pdxp	T	A	15: 78,918,259	M231K	probably damaging	Het
Pi4ka	A	G	16: 17,299,453	L1368P		Het
Ppie	T	C	4: 123,130,551	N171S	possibly damaging	Het
Rimbp2	T	C	5: 128,788,292	H657R	probably benign	Het
Sarnp	T	A	10: 128,821,973		probably null	Het
Serpinb9c	T	C	13: 33,150,346	T266A	probably damaging	Het
Srgap3	T	A	6: 112,780,893	I218F	possibly damaging	Het
Susd1	C	A	4: 59,324,882	W717L	probably benign	Het
Tgfbi	A	G	13: 56,623,589	Y88C	probably damaging	Het
Tmc6	A	T	11: 117,770,482	F624Y	probably damaging	Het
Tnni2	A	G	7: 142,444,276	E172G	probably damaging	Het
Traf3ip1	T	C	1: 91,505,456	S316P	probably benign	Het
Tshr	C	A	12: 91,537,774	N495K	possibly damaging	Het
Ulk3	C	A	9: 57,593,259	A317E	probably damaging	Het
Usp24	T	C	4: 106,418,215	V2229A	possibly damaging	Het
Usp32	G	A	11: 85,053,951	R304C	probably damaging	Het
Usp40	C	T	1: 88,007,341	G28D	probably benign	Het
Vmn1r41	A	G	6: 89,747,127	K217E	possibly damaging	Het
Vmn2r73	T	A	7: 85,858,076	K676M	probably benign	Het
Vnn1	A	G	10: 23,899,451	T200A	possibly damaging	Het
Zc3hav1	A	G	6: 38,325,241	L698P	possibly damaging	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
R8924:Abca8b	UTSW	11	109947177	missense	probably benign	0.00
R9032:Abca8b	UTSW	11	109957247	missense	probably benign	0.04
R9099:Abca8b	UTSW	11	109980882	missense	probably damaging	1.00
R9124:Abca8b	UTSW	11	109937767	missense	probably damaging	0.97
R9178:Abca8b	UTSW	11	109950111	missense	probably benign	0.00
R9188:Abca8b	UTSW	11	109981735	nonsense	probably null
R9277:Abca8b	UTSW	11	109976521	missense	probably damaging	0.99
R9340:Abca8b	UTSW	11	109950113	missense	probably benign	0.43
R9371:Abca8b	UTSW	11	109967672	missense	probably damaging	1.00
R9382:Abca8b	UTSW	11	109979885	missense	probably benign
R9450:Abca8b	UTSW	11	109969104	missense	probably damaging	0.98
R9462:Abca8b	UTSW	11	109953607	missense
R9712:Abca8b	UTSW	11	109942337	missense	probably benign	0.30
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCATGAATCCAAGTTCTGGC -3'
(R):5'- CAACTCCCATAATGAGAGGCGG -3'

Sequencing Primer
(F):5'- GCATGAATCCAAGTTCTGGCTACAG -3'
(R):5'- GGTGTGATTCCCAAGCACCATC -3'

Posted On

2021-10-11