Incidental Mutation 'R9323:Ifi207'
ID 706297
Institutional Source Beutler Lab
Gene Symbol Ifi207
Ensembl Gene ENSMUSG00000073490
Gene Name interferon activated gene 207
Synonyms Pyhin-A, AI607873
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9323 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 173723427-173741747 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 173727577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 853 (N853K)
Ref Sequence ENSEMBL: ENSMUSP00000048129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]
AlphaFold E9Q3L4
Predicted Effect probably damaging
Transcript: ENSMUST00000042610
AA Change: N853K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: N853K

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 162 N/A INTRINSIC
low complexity region 207 215 N/A INTRINSIC
internal_repeat_1 286 472 4.17e-7 PROSPERO
low complexity region 476 496 N/A INTRINSIC
internal_repeat_1 565 782 4.17e-7 PROSPERO
Pfam:HIN 788 954 4.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000127730
AA Change: N846K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: N846K

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
internal_repeat_1 279 465 6.41e-7 PROSPERO
low complexity region 469 489 N/A INTRINSIC
internal_repeat_1 558 775 6.41e-7 PROSPERO
Pfam:HIN 781 948 1.8e-78 PFAM
Meta Mutation Damage Score 0.1804 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,718,413 S54P unknown Het
5430419D17Rik T A 7: 131,226,672 N285K probably damaging Het
Abat G A 16: 8,602,371 W178* probably null Het
Alx1 G A 10: 103,022,263 R192* probably null Het
Apom A G 17: 35,131,657 C23R probably damaging Het
Asap2 A G 12: 21,112,147 N35S probably benign Het
Atf6 A T 1: 170,855,113 Y43* probably null Het
Bag4 T C 8: 25,771,333 S127G possibly damaging Het
Bag4 G T 8: 25,785,152 S7* probably null Het
Ccdc88b A G 19: 6,849,107 L1080P probably damaging Het
Cdkl2 A T 5: 92,020,248 D362E probably benign Het
Cep170 A G 1: 176,758,502 S575P probably benign Het
Col4a2 C T 8: 11,443,413 P1374L possibly damaging Het
Cpt2 T C 4: 107,904,359 H617R probably benign Het
Cyp2d22 A G 15: 82,374,006 S138P probably damaging Het
Cyp2j11 T C 4: 96,307,382 D359G probably benign Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Dmrtc2 A T 7: 24,872,916 I121F probably benign Het
Dus1l C T 11: 120,793,898 R149H probably damaging Het
Fam214a C T 9: 74,976,133 probably benign Het
Fam35a A G 14: 34,259,639 V514A probably damaging Het
Fam90a1a T A 8: 21,963,624 Y332N probably benign Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Grpel1 T A 5: 36,470,663 V96E possibly damaging Het
Igkv4-80 C T 6: 69,016,767 A47T probably damaging Het
Il1a T A 2: 129,307,906 I25F probably benign Het
Ireb2 T A 9: 54,904,239 probably null Het
Itpr1 A G 6: 108,352,018 Y131C probably damaging Het
Kmt2a T C 9: 44,819,964 probably benign Het
Lancl1 T A 1: 67,038,635 probably benign Het
Lpl G A 8: 68,887,544 V64M possibly damaging Het
March10 T C 11: 105,389,755 H568R probably damaging Het
Mib1 G A 18: 10,775,685 V546M probably damaging Het
Mss51 A T 14: 20,484,871 I277N probably benign Het
Mybpc1 A G 10: 88,524,967 probably null Het
Myct1 A C 10: 5,604,195 I21L probably benign Het
Myo5c C A 9: 75,246,249 A139E probably damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Npy2r A T 3: 82,540,421 I349N possibly damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Olfr113 A C 17: 37,575,244 Y60D probably damaging Het
Olfr478 C T 7: 108,032,023 V107I probably benign Het
Olfr659 T C 7: 104,671,013 F104L possibly damaging Het
Olfr803 A T 10: 129,691,960 V27D probably benign Het
Olfr930 T C 9: 38,930,522 V117A probably benign Het
Olfr978 T C 9: 39,994,064 S85P possibly damaging Het
Pde6b A T 5: 108,403,432 N194I probably damaging Het
Polg TCTGGATGA TCTGGATGACTGGATGA 7: 79,465,031 probably null Het
Polg GA GACTGGAGCA 7: 79,465,038 probably null Het
Ptpn9 T C 9: 57,027,417 M155T possibly damaging Het
Ret A G 6: 118,182,014 Y146H probably benign Het
Sdf2l1 T C 16: 17,131,634 H116R probably damaging Het
Slc37a1 T C 17: 31,333,669 I316T probably damaging Het
Slc4a11 A C 2: 130,686,910 L473R possibly damaging Het
Smg7 A G 1: 152,856,002 M344T probably benign Het
Smg9 T C 7: 24,415,040 L268P probably damaging Het
Tiparp C T 3: 65,531,851 T196I probably benign Het
Trappc12 A G 12: 28,692,492 probably null Het
Trappc9 A T 15: 72,693,582 N953K probably benign Het
Trpa1 A G 1: 14,898,340 V428A probably benign Het
Utp20 T C 10: 88,747,308 R2728G probably damaging Het
Zfp612 A G 8: 110,088,740 E193G probably benign Het
Other mutations in Ifi207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Ifi207 APN 1 173725044 missense probably damaging 1.00
IGL01864:Ifi207 APN 1 173736441 missense possibly damaging 0.72
IGL02293:Ifi207 APN 1 173723748 missense probably damaging 1.00
IGL02402:Ifi207 APN 1 173727593 missense probably damaging 1.00
IGL03160:Ifi207 APN 1 173735104 splice site probably benign
PIT4458001:Ifi207 UTSW 1 173735172 missense unknown
R0043:Ifi207 UTSW 1 173729112 missense possibly damaging 0.48
R0212:Ifi207 UTSW 1 173736398 missense possibly damaging 0.85
R0395:Ifi207 UTSW 1 173729865 missense possibly damaging 0.85
R0506:Ifi207 UTSW 1 173736312 missense possibly damaging 0.52
R0843:Ifi207 UTSW 1 173727577 missense probably damaging 1.00
R1302:Ifi207 UTSW 1 173735295 missense possibly damaging 0.96
R1373:Ifi207 UTSW 1 173730347 missense unknown
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1471:Ifi207 UTSW 1 173730063 missense unknown
R1502:Ifi207 UTSW 1 173729306 missense possibly damaging 0.56
R1533:Ifi207 UTSW 1 173727740 missense probably benign 0.30
R1831:Ifi207 UTSW 1 173732426 missense unknown
R1928:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R1982:Ifi207 UTSW 1 173735239 missense probably benign 0.01
R2132:Ifi207 UTSW 1 173729771 missense possibly damaging 0.84
R2248:Ifi207 UTSW 1 173736470 splice site probably benign
R3703:Ifi207 UTSW 1 173727463 nonsense probably null
R3741:Ifi207 UTSW 1 173727562 missense probably damaging 1.00
R3846:Ifi207 UTSW 1 173735303 missense probably benign 0.33
R4747:Ifi207 UTSW 1 173729067 missense probably benign 0.00
R4772:Ifi207 UTSW 1 173727687 missense probably damaging 1.00
R4776:Ifi207 UTSW 1 173730056 missense unknown
R4855:Ifi207 UTSW 1 173729815 missense probably damaging 0.96
R5170:Ifi207 UTSW 1 173730498 missense unknown
R5244:Ifi207 UTSW 1 173729937 missense probably benign 0.04
R5280:Ifi207 UTSW 1 173730304 missense unknown
R5301:Ifi207 UTSW 1 173729411 missense possibly damaging 0.83
R5334:Ifi207 UTSW 1 173727531 missense probably benign 0.21
R5445:Ifi207 UTSW 1 173727797 missense probably damaging 0.99
R5691:Ifi207 UTSW 1 173732426 missense unknown
R5838:Ifi207 UTSW 1 173732387 missense unknown
R6060:Ifi207 UTSW 1 173730527 missense unknown
R6220:Ifi207 UTSW 1 173729546 missense probably damaging 0.99
R6264:Ifi207 UTSW 1 173727545 missense probably damaging 1.00
R6307:Ifi207 UTSW 1 173725053 missense probably damaging 1.00
R6326:Ifi207 UTSW 1 173729966 missense probably benign 0.01
R6394:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R6532:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R6660:Ifi207 UTSW 1 173729406 missense probably benign 0.01
R6893:Ifi207 UTSW 1 173727642 missense possibly damaging 0.95
R7190:Ifi207 UTSW 1 173730252 missense unknown
R7192:Ifi207 UTSW 1 173729018 missense not run
R7194:Ifi207 UTSW 1 173729924 missense possibly damaging 0.84
R7327:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R7348:Ifi207 UTSW 1 173729196 small deletion probably benign
R7404:Ifi207 UTSW 1 173728928 missense possibly damaging 0.92
R7442:Ifi207 UTSW 1 173727431 missense probably benign 0.03
R7784:Ifi207 UTSW 1 173730132 missense unknown
R8041:Ifi207 UTSW 1 173727702 missense possibly damaging 0.78
R8116:Ifi207 UTSW 1 173730180 missense unknown
R8383:Ifi207 UTSW 1 173729204 small deletion probably benign
R8388:Ifi207 UTSW 1 173729450 frame shift probably null
R8389:Ifi207 UTSW 1 173729450 frame shift probably null
R8390:Ifi207 UTSW 1 173729450 frame shift probably null
R8399:Ifi207 UTSW 1 173730278 missense unknown
R8431:Ifi207 UTSW 1 173730504 missense unknown
R8474:Ifi207 UTSW 1 173729039 missense possibly damaging 0.63
R8505:Ifi207 UTSW 1 173729450 frame shift probably null
R9009:Ifi207 UTSW 1 173727816 missense probably damaging 0.97
R9071:Ifi207 UTSW 1 173730198 missense unknown
R9090:Ifi207 UTSW 1 173729196 small deletion probably benign
R9299:Ifi207 UTSW 1 173728995 small deletion probably benign
R9407:Ifi207 UTSW 1 173727668 missense probably damaging 1.00
R9493:Ifi207 UTSW 1 173728956 missense probably benign 0.00
RF009:Ifi207 UTSW 1 173728992 missense probably benign 0.00
RF011:Ifi207 UTSW 1 173729121 missense not run
RF032:Ifi207 UTSW 1 173735157 small deletion probably benign
X0003:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0004:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0005:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0009:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0010:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0011:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0012:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0013:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0014:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0017:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0018:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0019:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0020:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0021:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0022:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0023:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0024:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0025:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0026:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0027:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0028:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0033:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0034:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0035:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0036:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0037:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0038:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0039:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0040:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0050:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0052:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0053:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0054:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0057:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0058:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0060:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0061:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0062:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0063:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0064:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0065:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0066:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0067:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
Z1177:Ifi207 UTSW 1 173729579 missense probably damaging 1.00
Z1187:Ifi207 UTSW 1 173730527 missense unknown
Z1192:Ifi207 UTSW 1 173730527 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGATTGCAGAGGACATTTTACAAG -3'
(R):5'- GGTCCCAAACAAGTGATGGTG -3'

Sequencing Primer
(F):5'- ACAAGTATTGCAATGGCTTACC -3'
(R):5'- GTGCTGAAAGTAACAGAACCATTTAC -3'
Posted On 2022-04-18