Incidental Mutation 'R9323:Trappc9'
ID 706345
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9323 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 72589620-73061204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 72693582 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 953 (N953K)
Ref Sequence ENSEMBL: ENSMUSP00000087202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: N774K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: N774K

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
AA Change: N953K

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: N953K

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,718,413 S54P unknown Het
5430419D17Rik T A 7: 131,226,672 N285K probably damaging Het
Abat G A 16: 8,602,371 W178* probably null Het
Alx1 G A 10: 103,022,263 R192* probably null Het
Apom A G 17: 35,131,657 C23R probably damaging Het
Asap2 A G 12: 21,112,147 N35S probably benign Het
Atf6 A T 1: 170,855,113 Y43* probably null Het
Bag4 T C 8: 25,771,333 S127G possibly damaging Het
Bag4 G T 8: 25,785,152 S7* probably null Het
Ccdc88b A G 19: 6,849,107 L1080P probably damaging Het
Cdkl2 A T 5: 92,020,248 D362E probably benign Het
Cep170 A G 1: 176,758,502 S575P probably benign Het
Col4a2 C T 8: 11,443,413 P1374L possibly damaging Het
Cpt2 T C 4: 107,904,359 H617R probably benign Het
Cyp2d22 A G 15: 82,374,006 S138P probably damaging Het
Cyp2j11 T C 4: 96,307,382 D359G probably benign Het
Ddb2 T C 2: 91,211,992 S419G possibly damaging Het
Dmrtc2 A T 7: 24,872,916 I121F probably benign Het
Dus1l C T 11: 120,793,898 R149H probably damaging Het
Fam214a C T 9: 74,976,133 probably benign Het
Fam35a A G 14: 34,259,639 V514A probably damaging Het
Fam90a1a T A 8: 21,963,624 Y332N probably benign Het
Fbxo47 A T 11: 97,879,428 V46D probably benign Het
Grpel1 T A 5: 36,470,663 V96E possibly damaging Het
Ifi207 A T 1: 173,727,577 N853K probably damaging Het
Igkv4-80 C T 6: 69,016,767 A47T probably damaging Het
Il1a T A 2: 129,307,906 I25F probably benign Het
Ireb2 T A 9: 54,904,239 probably null Het
Itpr1 A G 6: 108,352,018 Y131C probably damaging Het
Kmt2a T C 9: 44,819,964 probably benign Het
Lancl1 T A 1: 67,038,635 probably benign Het
Lpl G A 8: 68,887,544 V64M possibly damaging Het
March10 T C 11: 105,389,755 H568R probably damaging Het
Mib1 G A 18: 10,775,685 V546M probably damaging Het
Mss51 A T 14: 20,484,871 I277N probably benign Het
Mybpc1 A G 10: 88,524,967 probably null Het
Myct1 A C 10: 5,604,195 I21L probably benign Het
Myo5c C A 9: 75,246,249 A139E probably damaging Het
Nlrp4e C G 7: 23,321,330 A414G probably benign Het
Npy2r A T 3: 82,540,421 I349N possibly damaging Het
Nrap T C 19: 56,389,823 I19V probably benign Het
Olfr113 A C 17: 37,575,244 Y60D probably damaging Het
Olfr478 C T 7: 108,032,023 V107I probably benign Het
Olfr659 T C 7: 104,671,013 F104L possibly damaging Het
Olfr803 A T 10: 129,691,960 V27D probably benign Het
Olfr930 T C 9: 38,930,522 V117A probably benign Het
Olfr978 T C 9: 39,994,064 S85P possibly damaging Het
Pde6b A T 5: 108,403,432 N194I probably damaging Het
Polg TCTGGATGA TCTGGATGACTGGATGA 7: 79,465,031 probably null Het
Polg GA GACTGGAGCA 7: 79,465,038 probably null Het
Ptpn9 T C 9: 57,027,417 M155T possibly damaging Het
Ret A G 6: 118,182,014 Y146H probably benign Het
Sdf2l1 T C 16: 17,131,634 H116R probably damaging Het
Slc37a1 T C 17: 31,333,669 I316T probably damaging Het
Slc4a11 A C 2: 130,686,910 L473R possibly damaging Het
Smg7 A G 1: 152,856,002 M344T probably benign Het
Smg9 T C 7: 24,415,040 L268P probably damaging Het
Tiparp C T 3: 65,531,851 T196I probably benign Het
Trappc12 A G 12: 28,692,492 probably null Het
Trpa1 A G 1: 14,898,340 V428A probably benign Het
Utp20 T C 10: 88,747,308 R2728G probably damaging Het
Zfp612 A G 8: 110,088,740 E193G probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
bronto UTSW 15 73058238 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
R8683:Trappc9 UTSW 15 73012815 missense probably benign 0.26
R8839:Trappc9 UTSW 15 73058238 nonsense probably null
R8945:Trappc9 UTSW 15 73058096 missense probably benign
R9083:Trappc9 UTSW 15 72736777 nonsense probably null
R9329:Trappc9 UTSW 15 72801353 missense unknown
R9366:Trappc9 UTSW 15 72937088 missense probably benign
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- TGGTCCATATCCTGCCATGC -3'
(R):5'- TCAGACTGTCTCATGCTGGC -3'

Sequencing Primer
(F):5'- GCCATGCCATTTGAAGCTG -3'
(R):5'- GCATGTGCTGACTCTCCAACAG -3'
Posted On 2022-04-18