Incidental Mutation 'R9734:Stim1'
ID 731610
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9734 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 101917013-102086526 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102064560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 210 (H210R)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect possibly damaging
Transcript: ENSMUST00000033289
AA Change: H210R

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: H210R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209255
AA Change: H210R

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000211457
AA Change: H210R

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 T A 4: 152,345,474 (GRCm39) V348E probably damaging Het
Adgrf5 T C 17: 43,763,199 (GRCm39) L1270P probably damaging Het
Akap12 C T 10: 4,305,929 (GRCm39) T1018M probably damaging Het
Bnip3l G A 14: 67,246,214 (GRCm39) P7L possibly damaging Het
Bod1l A T 5: 41,962,573 (GRCm39) D2721E possibly damaging Het
Bri3bp G T 5: 125,518,736 (GRCm39) R4L unknown Het
Cnbd2 T A 2: 156,180,540 (GRCm39) N241K possibly damaging Het
Cpne2 A G 8: 95,295,228 (GRCm39) I438V probably benign Het
Crybg2 A G 4: 133,801,962 (GRCm39) T732A probably benign Het
D6Ertd527e G C 6: 87,088,839 (GRCm39) S334T unknown Het
Dbt T C 3: 116,339,704 (GRCm39) V364A probably benign Het
Fbn1 A G 2: 125,231,898 (GRCm39) V412A probably benign Het
Fsip1 T A 2: 118,070,916 (GRCm39) Q258L probably benign Het
Gabrg3 A G 7: 56,634,908 (GRCm39) Y92H probably damaging Het
Grid1 C A 14: 35,302,742 (GRCm39) D1002E probably benign Het
Guf1 T A 5: 69,726,605 (GRCm39) C565* probably null Het
Iqce G T 5: 140,678,564 (GRCm39) R127S probably damaging Het
Lama3 A T 18: 12,682,320 (GRCm39) E1095D possibly damaging Het
Lamb2 G T 9: 108,365,830 (GRCm39) G1445W probably damaging Het
Mmp25 C T 17: 23,850,834 (GRCm39) V367M possibly damaging Het
Mucl3 T A 17: 35,949,233 (GRCm39) D122V probably benign Het
Or10d4c T C 9: 39,558,202 (GRCm39) F60S probably damaging Het
Or8b3b A T 9: 38,584,239 (GRCm39) I167N probably benign Het
Pramel30 A G 4: 144,057,737 (GRCm39) M115V probably benign Het
Rusc1 A T 3: 88,996,496 (GRCm39) S696T probably damaging Het
Scamp2 T G 9: 57,490,175 (GRCm39) F225V possibly damaging Het
Vil1 T C 1: 74,454,309 (GRCm39) I24T possibly damaging Het
Vmn1r218 T A 13: 23,321,034 (GRCm39) L127H probably damaging Het
Vmn2r29 A G 7: 7,234,492 (GRCm39) V798A probably damaging Het
Vmn2r68 T A 7: 84,882,757 (GRCm39) T332S possibly damaging Het
Zfp366 A G 13: 99,365,352 (GRCm39) Y171C probably damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102,075,954 (GRCm39) missense probably damaging 1.00
IGL01390:Stim1 APN 7 102,076,369 (GRCm39) missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102,035,322 (GRCm39) missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102,035,322 (GRCm39) missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102,075,176 (GRCm39) splice site probably benign
IGL01826:Stim1 APN 7 102,076,282 (GRCm39) splice site probably benign
IGL01908:Stim1 APN 7 102,084,857 (GRCm39) missense probably benign
IGL02869:Stim1 APN 7 101,917,758 (GRCm39) missense unknown
IGL03146:Stim1 APN 7 102,070,562 (GRCm39) missense probably damaging 1.00
R0217:Stim1 UTSW 7 102,085,007 (GRCm39) missense probably benign 0.00
R1320:Stim1 UTSW 7 102,057,613 (GRCm39) missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102,003,748 (GRCm39) missense probably benign 0.31
R1643:Stim1 UTSW 7 102,035,307 (GRCm39) missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102,003,713 (GRCm39) missense probably damaging 1.00
R2424:Stim1 UTSW 7 102,057,612 (GRCm39) missense probably benign 0.03
R3838:Stim1 UTSW 7 102,060,503 (GRCm39) missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102,084,848 (GRCm39) missense probably benign 0.00
R4820:Stim1 UTSW 7 102,064,571 (GRCm39) missense probably damaging 0.97
R4871:Stim1 UTSW 7 102,003,779 (GRCm39) missense probably damaging 1.00
R5110:Stim1 UTSW 7 101,917,629 (GRCm39) missense unknown
R5787:Stim1 UTSW 7 102,084,647 (GRCm39) missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102,080,157 (GRCm39) missense probably null 0.99
R6788:Stim1 UTSW 7 102,076,498 (GRCm39) missense probably damaging 0.99
R7112:Stim1 UTSW 7 102,057,615 (GRCm39) missense probably benign 0.01
R7125:Stim1 UTSW 7 102,084,741 (GRCm39) missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102,070,739 (GRCm39) critical splice donor site probably null
R7650:Stim1 UTSW 7 102,078,034 (GRCm39) missense
R7807:Stim1 UTSW 7 102,076,348 (GRCm39) missense probably damaging 0.99
R8304:Stim1 UTSW 7 102,084,688 (GRCm39) missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102,076,324 (GRCm39) missense probably damaging 1.00
R8528:Stim1 UTSW 7 102,080,289 (GRCm39) intron probably benign
R8883:Stim1 UTSW 7 102,080,257 (GRCm39) missense unknown
R8921:Stim1 UTSW 7 102,070,597 (GRCm39) missense probably damaging 0.99
R8924:Stim1 UTSW 7 102,078,014 (GRCm39) missense
R9018:Stim1 UTSW 7 102,060,482 (GRCm39) missense probably benign 0.05
R9164:Stim1 UTSW 7 102,084,626 (GRCm39) missense probably benign 0.35
R9396:Stim1 UTSW 7 102,064,592 (GRCm39) missense possibly damaging 0.63
R9487:Stim1 UTSW 7 102,080,257 (GRCm39) missense unknown
R9501:Stim1 UTSW 7 102,060,506 (GRCm39) missense possibly damaging 0.92
R9697:Stim1 UTSW 7 102,078,014 (GRCm39) missense
R9710:Stim1 UTSW 7 102,080,118 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAAGGAGGACTTGGCAG -3'
(R):5'- GGAGACTTCTAAGAGCTGGTAG -3'

Sequencing Primer
(F):5'- GAGAGATAGGCACAGACTTTATTATG -3'
(R):5'- CCTGATCTACAAAGTGAGTTCCAGG -3'
Posted On 2022-11-14