Incidental Mutation 'R9164:Stim1'
ID 695921
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102267806-102437319 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102435419 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 526 (H526R)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably benign
Transcript: ENSMUST00000033289
AA Change: H526R

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: H526R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209255
AA Change: H634R
Predicted Effect probably benign
Transcript: ENSMUST00000211058
Predicted Effect silent
Transcript: ENSMUST00000211457
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102427117 missense probably damaging 1.00
R8528:Stim1 UTSW 7 102431082 intron probably benign
R8883:Stim1 UTSW 7 102431050 missense unknown
R8921:Stim1 UTSW 7 102421390 missense probably damaging 0.99
R8924:Stim1 UTSW 7 102428807 missense
R9018:Stim1 UTSW 7 102411275 missense probably benign 0.05
R9396:Stim1 UTSW 7 102415385 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACACTGTCCTGATGACTTACTC -3'
(R):5'- TCTAGGCCATGGTTCAACGC -3'

Sequencing Primer
(F):5'- GTCCTGATGACTTACTCAACTTTC -3'
(R):5'- GCCATAAATGTCTTCTTGGCCAGAG -3'
Posted On 2022-02-07