Mutagenetix > Incidental Mutation

Incidental Mutation 'R8528:Stim1'

658898

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

068498-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8528 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 102431082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147410 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

probably benign
Transcript: ENSMUST00000033289

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000209255
AA Change: S558P

Predicted Effect

probably benign
Transcript: ENSMUST00000211058

Predicted Effect

probably benign
Transcript: ENSMUST00000211457

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	A	C	15: 74,575,851	I169L	possibly damaging	Het
Ahnak	A	T	19: 9,007,728	K2125N	probably damaging	Het
Arl5b	T	A	2: 15,073,327		probably null	Het
BC055324	T	C	1: 163,986,083	K191E	probably damaging	Het
Ccng2	T	C	5: 93,269,305	V60A	possibly damaging	Het
Cfap65	A	G	1: 74,905,937	V1442A	possibly damaging	Het
Cyp1b1	T	A	17: 79,710,564	E387D	probably damaging	Het
Dchs2	T	C	3: 83,354,611	S2729P	probably damaging	Het
Dnah11	A	G	12: 118,008,803	F2882S	probably damaging	Het
Dpy30	T	C	17: 74,299,762	D97G	probably benign	Het
Enam	T	A	5: 88,502,219	V454E	probably damaging	Het
Eppk1	C	T	15: 76,110,119	R854Q	probably benign	Het
Ero1lb	T	A	13: 12,599,868	C240*	probably null	Het
Exog	A	G	9: 119,462,620	D297G	probably damaging	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Fer1l5	A	G	1: 36,417,774	Y1611C	possibly damaging	Het
Frmpd1	T	C	4: 45,285,034	V1285A	probably benign	Het
Gfpt1	G	C	6: 87,066,788		probably null	Het
Gm15446	T	C	5: 109,943,030	Y383H	possibly damaging	Het
Gsdmc	A	T	15: 63,777,340		probably null	Het
Hao1	A	G	2: 134,522,993	I238T	probably damaging	Het
Kcnq5	G	A	1: 21,479,424	R360C	probably damaging	Het
Kcnv2	T	A	19: 27,322,987	D79E	probably benign	Het
Lrrc8a	T	C	2: 30,255,545	Y124H	probably damaging	Het
Lrrc8d	T	A	5: 105,812,486	M254K	probably benign	Het
Map3k4	T	C	17: 12,232,934	N1489S	probably damaging	Het
Mapk8ip2	A	G	15: 89,455,219	D34G	probably damaging	Het
Myo9a	A	G	9: 59,860,140	T876A	probably damaging	Het
Pabpc2	C	T	18: 39,775,386	T568I	probably benign	Het
Pcdhga2	G	T	18: 37,669,168	A22S	probably benign	Het
Rc3h2	G	A	2: 37,382,799	T755I	probably benign	Het
Sertad4	A	G	1: 192,851,083	V15A	probably benign	Het
Slc28a2	A	G	2: 122,455,742	K520E	probably damaging	Het
Slc4a10	T	C	2: 62,296,796	V831A	possibly damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spag17	A	T	3: 100,124,185	I2255F	possibly damaging	Het
Sprn	C	T	7: 140,153,510		probably benign	Het
Stk24	C	A	14: 121,292,035	A402S	probably benign	Het
Sycp2	A	G	2: 178,374,533	L712P	probably damaging	Het
Tenm3	C	T	8: 48,342,633	G269S	probably damaging	Het
Zdbf2	A	G	1: 63,303,386	E308G	possibly damaging	Het
Zfp442	A	C	2: 150,409,042	H312Q	probably damaging	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8921:Stim1	UTSW	7	102421390	missense	probably damaging	0.99
R8924:Stim1	UTSW	7	102428807	missense
R9018:Stim1	UTSW	7	102411275	missense	probably benign	0.05
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63
R9487:Stim1	UTSW	7	102431050	missense	unknown
R9501:Stim1	UTSW	7	102411299	missense	possibly damaging	0.92
R9697:Stim1	UTSW	7	102428807	missense
R9710:Stim1	UTSW	7	102430911	small deletion	probably benign
R9734:Stim1	UTSW	7	102415353	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- ATGGGTACATGCTTGCCTG -3'
(R):5'- ACAGCGATGTTGTCAGAAGG -3'

Sequencing Primer
(F):5'- GGTACATGCTTGCCTGCACAC -3'
(R):5'- TCAGAAGGGGTTGGGTCAG -3'

Posted On

2021-01-18