Incidental Mutation 'R8528:Stim1'
ID 658898
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8528 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102267806-102437319 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to C at 102431082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably benign
Transcript: ENSMUST00000033289
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209255
AA Change: S558P
Predicted Effect probably benign
Transcript: ENSMUST00000211058
Predicted Effect probably benign
Transcript: ENSMUST00000211457
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,575,851 I169L possibly damaging Het
Ahnak A T 19: 9,007,728 K2125N probably damaging Het
Arl5b T A 2: 15,073,327 probably null Het
BC055324 T C 1: 163,986,083 K191E probably damaging Het
Ccng2 T C 5: 93,269,305 V60A possibly damaging Het
Cfap65 A G 1: 74,905,937 V1442A possibly damaging Het
Cyp1b1 T A 17: 79,710,564 E387D probably damaging Het
Dchs2 T C 3: 83,354,611 S2729P probably damaging Het
Dnah11 A G 12: 118,008,803 F2882S probably damaging Het
Dpy30 T C 17: 74,299,762 D97G probably benign Het
Enam T A 5: 88,502,219 V454E probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Ero1lb T A 13: 12,599,868 C240* probably null Het
Exog A G 9: 119,462,620 D297G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fer1l5 A G 1: 36,417,774 Y1611C possibly damaging Het
Frmpd1 T C 4: 45,285,034 V1285A probably benign Het
Gfpt1 G C 6: 87,066,788 probably null Het
Gm15446 T C 5: 109,943,030 Y383H possibly damaging Het
Gsdmc A T 15: 63,777,340 probably null Het
Hao1 A G 2: 134,522,993 I238T probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kcnv2 T A 19: 27,322,987 D79E probably benign Het
Lrrc8a T C 2: 30,255,545 Y124H probably damaging Het
Lrrc8d T A 5: 105,812,486 M254K probably benign Het
Map3k4 T C 17: 12,232,934 N1489S probably damaging Het
Mapk8ip2 A G 15: 89,455,219 D34G probably damaging Het
Myo9a A G 9: 59,860,140 T876A probably damaging Het
Pabpc2 C T 18: 39,775,386 T568I probably benign Het
Pcdhga2 G T 18: 37,669,168 A22S probably benign Het
Rc3h2 G A 2: 37,382,799 T755I probably benign Het
Sertad4 A G 1: 192,851,083 V15A probably benign Het
Slc28a2 A G 2: 122,455,742 K520E probably damaging Het
Slc4a10 T C 2: 62,296,796 V831A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Sprn C T 7: 140,153,510 probably benign Het
Stk24 C A 14: 121,292,035 A402S probably benign Het
Sycp2 A G 2: 178,374,533 L712P probably damaging Het
Tenm3 C T 8: 48,342,633 G269S probably damaging Het
Zdbf2 A G 1: 63,303,386 E308G possibly damaging Het
Zfp442 A C 2: 150,409,042 H312Q probably damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102427117 missense probably damaging 1.00
R8883:Stim1 UTSW 7 102431050 missense unknown
R8921:Stim1 UTSW 7 102421390 missense probably damaging 0.99
R8924:Stim1 UTSW 7 102428807 missense
R9018:Stim1 UTSW 7 102411275 missense probably benign 0.05
R9164:Stim1 UTSW 7 102435419 missense probably benign 0.35
R9396:Stim1 UTSW 7 102415385 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATGGGTACATGCTTGCCTG -3'
(R):5'- ACAGCGATGTTGTCAGAAGG -3'

Sequencing Primer
(F):5'- GGTACATGCTTGCCTGCACAC -3'
(R):5'- TCAGAAGGGGTTGGGTCAG -3'
Posted On 2021-01-18