Incidental Mutation 'R9789:Olfr118'
ID 734575
Institutional Source Beutler Lab
Gene Symbol Olfr118
Ensembl Gene ENSMUSG00000080990
Gene Name olfactory receptor 118
Synonyms MOR263-13, GA_x6K02T2PSCP-2131124-2132089
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R9789 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37666988-37673476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37672168 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 48 (N48K)
Ref Sequence ENSEMBL: ENSMUSP00000150176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122036] [ENSMUST00000215811] [ENSMUST00000216551]
AlphaFold Q7TRJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000122036
AA Change: N48K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113988
Gene: ENSMUSG00000080990
AA Change: N48K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 32 173 2e-6 PFAM
Pfam:7tm_4 37 314 2.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 41 311 5.8e-6 PFAM
Pfam:7tm_1 47 296 1.4e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215811
AA Change: N48K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216551
AA Change: N48K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,184,583 S1038R probably benign Het
Aar2 T C 2: 156,550,825 F45L probably damaging Het
Abcg2 A G 6: 58,664,548 Y122C probably damaging Het
Arfgef1 A T 1: 10,173,202 W1041R probably damaging Het
Ash1l A G 3: 88,966,066 N52S probably benign Het
Asrgl1 T A 19: 9,116,610 T185S probably damaging Het
Astl T A 2: 127,350,226 S234T probably damaging Het
Atp5j2 T C 5: 145,183,846 Y87C probably damaging Het
Atxn7l1 A T 12: 33,346,063 R264W probably damaging Het
Axin2 T C 11: 108,949,354 Y828H probably damaging Het
Bnipl T C 3: 95,245,829 D145G possibly damaging Het
C8b A T 4: 104,782,994 M165L probably benign Het
Cd109 T C 9: 78,634,662 L87P possibly damaging Het
Cdk17 C T 10: 93,225,029 P232S probably damaging Het
Cnot1 T C 8: 95,729,144 E1995G probably damaging Het
Csf2rb2 G A 15: 78,284,996 A653V probably benign Het
Cutc A G 19: 43,768,260 N264D probably benign Het
Cxcr4 C T 1: 128,589,147 W259* probably null Het
Dnah8 T C 17: 30,761,130 probably null Het
Dsp T C 13: 38,183,961 I652T probably benign Het
Dstyk A T 1: 132,454,121 M538L probably benign Het
Eppk1 T A 15: 76,109,019 I1221F probably benign Het
Ern2 T A 7: 122,170,262 Y847F probably damaging Het
Exosc7 T A 9: 123,130,925 V197D probably damaging Het
Gabra1 T C 11: 42,133,525 Y441C probably damaging Het
Garem1 G A 18: 21,129,928 P610S possibly damaging Het
Garem2 T A 5: 30,114,332 V264E probably damaging Het
Gata2 G A 6: 88,200,290 G101S probably benign Het
Gcnt4 A G 13: 96,946,921 T242A probably benign Het
Ghitm A C 14: 37,130,762 Y120* probably null Het
Gimap7 A G 6: 48,723,536 S19G probably damaging Het
Gm5475 G A 15: 100,427,000 G103E unknown Het
Gstcd A T 3: 133,084,596 C137S probably damaging Het
Gtf2b AATCATC AATC 3: 142,771,417 probably benign Het
Hfm1 T C 5: 106,917,480 D111G probably benign Het
Ighg2b A G 12: 113,306,684 I238T Het
Il2ra A C 2: 11,680,350 M166L probably benign Het
Itga1 A T 13: 115,035,284 L95* probably null Het
Itpr3 A G 17: 27,089,941 T373A probably benign Het
Klhl28 A G 12: 64,950,097 V490A probably damaging Het
Kntc1 A T 5: 123,760,643 N200I possibly damaging Het
L3mbtl4 A G 17: 68,459,799 K167R probably benign Het
Lgals1 A T 15: 78,929,730 T63S probably benign Het
Lnpep C A 17: 17,575,334 C305F probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mcmbp A G 7: 128,709,859 I310T possibly damaging Het
Mical2 G A 7: 112,346,789 R986H probably damaging Het
Muc5b A T 7: 141,861,593 S2759C possibly damaging Het
Myh7 A G 14: 54,991,927 V138A possibly damaging Het
Ncr1 T G 7: 4,341,301 probably null Het
Ndufa10 A T 1: 92,469,888 D145E possibly damaging Het
Neo1 T A 9: 58,894,024 probably null Het
Ninl A T 2: 150,949,781 S941T probably benign Het
Nrm T A 17: 35,861,519 probably null Het
Nup214 T C 2: 32,017,215 V1018A possibly damaging Het
Odf1 A G 15: 38,219,472 I15V probably benign Het
Olfr1023 C T 2: 85,886,994 H65Y probably damaging Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr32 T A 2: 90,138,660 T160S probably benign Het
Olfr376 A T 11: 73,374,884 N48I probably damaging Het
Olfr490 A T 7: 108,286,691 V145D probably benign Het
Olfr670 A T 7: 104,960,450 I94N probably damaging Het
Olfr850 C A 9: 19,478,086 D55Y probably benign Het
Osgin2 A T 4: 15,998,957 Y222N probably damaging Het
Pcdhga10 T C 18: 37,749,310 V708A probably benign Het
Pfn3 T C 13: 55,415,087 D27G possibly damaging Het
Plch2 A G 4: 155,010,865 probably null Het
Plin2 C A 4: 86,658,677 Q270H probably damaging Het
Polk A G 13: 96,493,895 F386S probably damaging Het
Prkar1a G A 11: 109,665,952 G286E probably damaging Het
Prodh A T 16: 18,080,185 L276Q probably damaging Het
Ranbp10 T C 8: 105,786,674 N202S probably damaging Het
Rapgef6 C A 11: 54,649,271 T724K probably benign Het
Rnf144a T A 12: 26,327,575 K56N probably benign Het
Rpa1 T A 11: 75,313,112 K303I probably damaging Het
Slc16a9 A C 10: 70,282,510 N220H possibly damaging Het
Slc28a3 T C 13: 58,576,850 I197V probably benign Het
Slc35d1 A T 4: 103,214,749 F19I Het
Sohlh2 A T 3: 55,192,300 E164D probably damaging Het
Sord A T 2: 122,263,284 K295* probably null Het
Spata31d1b A G 13: 59,712,382 Y23C probably benign Het
Stard9 T A 2: 120,679,936 Y333N probably damaging Het
Tas2r107 A G 6: 131,659,790 F99L probably damaging Het
Thap12 C T 7: 98,703,385 probably benign Het
Tmprss9 A T 10: 80,895,159 T840S probably benign Het
Trim16 T A 11: 62,829,200 probably null Het
Ttc16 C T 2: 32,774,793 probably null Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Unc80 A T 1: 66,612,212 Y1572F possibly damaging Het
Usp42 G T 5: 143,720,305 A320D possibly damaging Het
Vmn2r94 T C 17: 18,243,776 T751A probably damaging Het
Zbtb41 C T 1: 139,440,346 L591F probably damaging Het
Zdhhc5 T A 2: 84,694,318 E219D probably damaging Het
Zfp248 A T 6: 118,429,051 F526I probably damaging Het
Zfp322a T C 13: 23,356,388 K395E possibly damaging Het
Zfp423 G A 8: 87,780,249 P1156S probably benign Het
Zfp644 T C 5: 106,638,265 T139A possibly damaging Het
Other mutations in Olfr118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Olfr118 APN 17 37672887 missense probably damaging 1.00
IGL02456:Olfr118 APN 17 37672449 missense possibly damaging 0.90
IGL02750:Olfr118 APN 17 37672609 nonsense probably null
IGL03083:Olfr118 APN 17 37672660 nonsense probably null
IGL03339:Olfr118 APN 17 37672557 missense possibly damaging 0.87
R0032:Olfr118 UTSW 17 37672487 missense probably damaging 1.00
R1457:Olfr118 UTSW 17 37672925 nonsense probably null
R1542:Olfr118 UTSW 17 37672251 missense probably damaging 1.00
R1771:Olfr118 UTSW 17 37672663 missense probably damaging 1.00
R1893:Olfr118 UTSW 17 37672856 nonsense probably null
R2395:Olfr118 UTSW 17 37672696 nonsense probably null
R3619:Olfr118 UTSW 17 37672640 missense probably benign 0.05
R3917:Olfr118 UTSW 17 37672793 missense probably damaging 1.00
R3937:Olfr118 UTSW 17 37672967 missense probably benign 0.01
R5600:Olfr118 UTSW 17 37672285 missense possibly damaging 0.91
R6415:Olfr118 UTSW 17 37672557 missense possibly damaging 0.87
R6462:Olfr118 UTSW 17 37672220 missense probably damaging 1.00
R7355:Olfr118 UTSW 17 37672410 missense probably benign 0.02
R7861:Olfr118 UTSW 17 37672517 missense possibly damaging 0.91
R7913:Olfr118 UTSW 17 37672108 missense probably benign
R7952:Olfr118 UTSW 17 37672817 missense probably damaging 1.00
R7969:Olfr118 UTSW 17 37672656 missense probably damaging 1.00
R8879:Olfr118 UTSW 17 37672411 nonsense probably null
R8923:Olfr118 UTSW 17 37672811 missense probably benign 0.00
R9253:Olfr118 UTSW 17 37672746 missense probably benign 0.00
R9778:Olfr118 UTSW 17 37672254 missense probably damaging 0.97
RF003:Olfr118 UTSW 17 37672858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCTAATGATTTGCTGTCCTTTC -3'
(R):5'- TGTAGCGGTCAAAGGCCATG -3'

Sequencing Primer
(F):5'- CTTTCAGGAGATGAGTGTCAACTGC -3'
(R):5'- TGGCTGCCAATAGACAGC -3'
Posted On 2022-11-14