Incidental Mutation 'R9789:Rapgef6'
ID 734543
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9789 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 54522847-54699285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 54649271 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 724 (T724K)
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429] [ENSMUST00000218995]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
AA Change: T439K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: T439K

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101206
AA Change: T724K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: T724K

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102743
AA Change: T724K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: T724K

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108894
AA Change: T439K

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: T439K

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: T724K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218995
AA Change: T577K

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,184,583 S1038R probably benign Het
Aar2 T C 2: 156,550,825 F45L probably damaging Het
Abcg2 A G 6: 58,664,548 Y122C probably damaging Het
Arfgef1 A T 1: 10,173,202 W1041R probably damaging Het
Ash1l A G 3: 88,966,066 N52S probably benign Het
Asrgl1 T A 19: 9,116,610 T185S probably damaging Het
Astl T A 2: 127,350,226 S234T probably damaging Het
Atp5j2 T C 5: 145,183,846 Y87C probably damaging Het
Atxn7l1 A T 12: 33,346,063 R264W probably damaging Het
Axin2 T C 11: 108,949,354 Y828H probably damaging Het
Bnipl T C 3: 95,245,829 D145G possibly damaging Het
C8b A T 4: 104,782,994 M165L probably benign Het
Cd109 T C 9: 78,634,662 L87P possibly damaging Het
Cdk17 C T 10: 93,225,029 P232S probably damaging Het
Cnot1 T C 8: 95,729,144 E1995G probably damaging Het
Csf2rb2 G A 15: 78,284,996 A653V probably benign Het
Cutc A G 19: 43,768,260 N264D probably benign Het
Cxcr4 C T 1: 128,589,147 W259* probably null Het
Dnah8 T C 17: 30,761,130 probably null Het
Dsp T C 13: 38,183,961 I652T probably benign Het
Dstyk A T 1: 132,454,121 M538L probably benign Het
Eppk1 T A 15: 76,109,019 I1221F probably benign Het
Ern2 T A 7: 122,170,262 Y847F probably damaging Het
Exosc7 T A 9: 123,130,925 V197D probably damaging Het
Gabra1 T C 11: 42,133,525 Y441C probably damaging Het
Garem1 G A 18: 21,129,928 P610S possibly damaging Het
Garem2 T A 5: 30,114,332 V264E probably damaging Het
Gata2 G A 6: 88,200,290 G101S probably benign Het
Gcnt4 A G 13: 96,946,921 T242A probably benign Het
Ghitm A C 14: 37,130,762 Y120* probably null Het
Gimap7 A G 6: 48,723,536 S19G probably damaging Het
Gm5475 G A 15: 100,427,000 G103E unknown Het
Gstcd A T 3: 133,084,596 C137S probably damaging Het
Gtf2b AATCATC AATC 3: 142,771,417 probably benign Het
Hfm1 T C 5: 106,917,480 D111G probably benign Het
Ighg2b A G 12: 113,306,684 I238T Het
Il2ra A C 2: 11,680,350 M166L probably benign Het
Itga1 A T 13: 115,035,284 L95* probably null Het
Itpr3 A G 17: 27,089,941 T373A probably benign Het
Klhl28 A G 12: 64,950,097 V490A probably damaging Het
Kntc1 A T 5: 123,760,643 N200I possibly damaging Het
L3mbtl4 A G 17: 68,459,799 K167R probably benign Het
Lgals1 A T 15: 78,929,730 T63S probably benign Het
Lnpep C A 17: 17,575,334 C305F probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mcmbp A G 7: 128,709,859 I310T possibly damaging Het
Mical2 G A 7: 112,346,789 R986H probably damaging Het
Muc5b A T 7: 141,861,593 S2759C possibly damaging Het
Myh7 A G 14: 54,991,927 V138A possibly damaging Het
Ncr1 T G 7: 4,341,301 probably null Het
Ndufa10 A T 1: 92,469,888 D145E possibly damaging Het
Neo1 T A 9: 58,894,024 probably null Het
Ninl A T 2: 150,949,781 S941T probably benign Het
Nrm T A 17: 35,861,519 probably null Het
Nup214 T C 2: 32,017,215 V1018A possibly damaging Het
Odf1 A G 15: 38,219,472 I15V probably benign Het
Olfr1023 C T 2: 85,886,994 H65Y probably damaging Het
Olfr118 T A 17: 37,672,168 N48K probably damaging Het
Olfr1406 C T 1: 173,183,891 R181H probably benign Het
Olfr32 T A 2: 90,138,660 T160S probably benign Het
Olfr376 A T 11: 73,374,884 N48I probably damaging Het
Olfr490 A T 7: 108,286,691 V145D probably benign Het
Olfr670 A T 7: 104,960,450 I94N probably damaging Het
Olfr850 C A 9: 19,478,086 D55Y probably benign Het
Osgin2 A T 4: 15,998,957 Y222N probably damaging Het
Pcdhga10 T C 18: 37,749,310 V708A probably benign Het
Pfn3 T C 13: 55,415,087 D27G possibly damaging Het
Plch2 A G 4: 155,010,865 probably null Het
Plin2 C A 4: 86,658,677 Q270H probably damaging Het
Polk A G 13: 96,493,895 F386S probably damaging Het
Prkar1a G A 11: 109,665,952 G286E probably damaging Het
Prodh A T 16: 18,080,185 L276Q probably damaging Het
Ranbp10 T C 8: 105,786,674 N202S probably damaging Het
Rnf144a T A 12: 26,327,575 K56N probably benign Het
Rpa1 T A 11: 75,313,112 K303I probably damaging Het
Slc16a9 A C 10: 70,282,510 N220H possibly damaging Het
Slc28a3 T C 13: 58,576,850 I197V probably benign Het
Slc35d1 A T 4: 103,214,749 F19I Het
Sohlh2 A T 3: 55,192,300 E164D probably damaging Het
Sord A T 2: 122,263,284 K295* probably null Het
Spata31d1b A G 13: 59,712,382 Y23C probably benign Het
Stard9 T A 2: 120,679,936 Y333N probably damaging Het
Tas2r107 A G 6: 131,659,790 F99L probably damaging Het
Thap12 C T 7: 98,703,385 probably benign Het
Tmprss9 A T 10: 80,895,159 T840S probably benign Het
Trim16 T A 11: 62,829,200 probably null Het
Ttc16 C T 2: 32,774,793 probably null Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Unc80 A T 1: 66,612,212 Y1572F possibly damaging Het
Usp42 G T 5: 143,720,305 A320D possibly damaging Het
Vmn2r94 T C 17: 18,243,776 T751A probably damaging Het
Zbtb41 C T 1: 139,440,346 L591F probably damaging Het
Zdhhc5 T A 2: 84,694,318 E219D probably damaging Het
Zfp248 A T 6: 118,429,051 F526I probably damaging Het
Zfp322a T C 13: 23,356,388 K395E possibly damaging Het
Zfp423 G A 8: 87,780,249 P1156S probably benign Het
Zfp644 T C 5: 106,638,265 T139A possibly damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8393:Rapgef6 UTSW 11 54687661 missense probably benign
R8465:Rapgef6 UTSW 11 54691482 missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54690237 missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54568469 missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54552874 critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54691566 nonsense probably null
R8921:Rapgef6 UTSW 11 54679239 missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54687841 missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54597086 nonsense probably null
R9354:Rapgef6 UTSW 11 54619923 missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54552858 missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54691343 missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54622363 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGACTAGCAAATTTTAAGCAGTCCC -3'
(R):5'- TCCCACTAGCTCTTTGCATGAAG -3'

Sequencing Primer
(F):5'- GCACCATTTTTGTTTACTGAGATG -3'
(R):5'- GAGTCGTATGAGTTACATGGG -3'
Posted On 2022-11-14