Mutagenetix > Incidental Mutation

Incidental Mutation 'R9789:Rapgef6'

734543

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9789 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 54649271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 724 (T724K)

Ref Sequence

ENSEMBL: ENSMUSP00000147135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429] [ENSMUST00000218995]

AlphaFold

Q5NCJ1

Predicted Effect

probably benign
Transcript: ENSMUST00000094536
AA Change: T439K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: T439K

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101206
AA Change: T724K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: T724K

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102743
AA Change: T724K

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: T724K

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108894
AA Change: T439K

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: T439K

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207429
AA Change: T724K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218995
AA Change: T577K

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	A	12: 71,184,583	S1038R	probably benign	Het
Aar2	T	C	2: 156,550,825	F45L	probably damaging	Het
Abcg2	A	G	6: 58,664,548	Y122C	probably damaging	Het
Arfgef1	A	T	1: 10,173,202	W1041R	probably damaging	Het
Ash1l	A	G	3: 88,966,066	N52S	probably benign	Het
Asrgl1	T	A	19: 9,116,610	T185S	probably damaging	Het
Astl	T	A	2: 127,350,226	S234T	probably damaging	Het
Atp5j2	T	C	5: 145,183,846	Y87C	probably damaging	Het
Atxn7l1	A	T	12: 33,346,063	R264W	probably damaging	Het
Axin2	T	C	11: 108,949,354	Y828H	probably damaging	Het
Bnipl	T	C	3: 95,245,829	D145G	possibly damaging	Het
C8b	A	T	4: 104,782,994	M165L	probably benign	Het
Cd109	T	C	9: 78,634,662	L87P	possibly damaging	Het
Cdk17	C	T	10: 93,225,029	P232S	probably damaging	Het
Cnot1	T	C	8: 95,729,144	E1995G	probably damaging	Het
Csf2rb2	G	A	15: 78,284,996	A653V	probably benign	Het
Cutc	A	G	19: 43,768,260	N264D	probably benign	Het
Cxcr4	C	T	1: 128,589,147	W259*	probably null	Het
Dnah8	T	C	17: 30,761,130		probably null	Het
Dsp	T	C	13: 38,183,961	I652T	probably benign	Het
Dstyk	A	T	1: 132,454,121	M538L	probably benign	Het
Eppk1	T	A	15: 76,109,019	I1221F	probably benign	Het
Ern2	T	A	7: 122,170,262	Y847F	probably damaging	Het
Exosc7	T	A	9: 123,130,925	V197D	probably damaging	Het
Gabra1	T	C	11: 42,133,525	Y441C	probably damaging	Het
Garem1	G	A	18: 21,129,928	P610S	possibly damaging	Het
Garem2	T	A	5: 30,114,332	V264E	probably damaging	Het
Gata2	G	A	6: 88,200,290	G101S	probably benign	Het
Gcnt4	A	G	13: 96,946,921	T242A	probably benign	Het
Ghitm	A	C	14: 37,130,762	Y120*	probably null	Het
Gimap7	A	G	6: 48,723,536	S19G	probably damaging	Het
Gm5475	G	A	15: 100,427,000	G103E	unknown	Het
Gstcd	A	T	3: 133,084,596	C137S	probably damaging	Het
Gtf2b	AATCATC	AATC	3: 142,771,417		probably benign	Het
Hfm1	T	C	5: 106,917,480	D111G	probably benign	Het
Ighg2b	A	G	12: 113,306,684	I238T		Het
Il2ra	A	C	2: 11,680,350	M166L	probably benign	Het
Itga1	A	T	13: 115,035,284	L95*	probably null	Het
Itpr3	A	G	17: 27,089,941	T373A	probably benign	Het
Klhl28	A	G	12: 64,950,097	V490A	probably damaging	Het
Kntc1	A	T	5: 123,760,643	N200I	possibly damaging	Het
L3mbtl4	A	G	17: 68,459,799	K167R	probably benign	Het
Lgals1	A	T	15: 78,929,730	T63S	probably benign	Het
Lnpep	C	A	17: 17,575,334	C305F	probably damaging	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Mcmbp	A	G	7: 128,709,859	I310T	possibly damaging	Het
Mical2	G	A	7: 112,346,789	R986H	probably damaging	Het
Muc5b	A	T	7: 141,861,593	S2759C	possibly damaging	Het
Myh7	A	G	14: 54,991,927	V138A	possibly damaging	Het
Ncr1	T	G	7: 4,341,301		probably null	Het
Ndufa10	A	T	1: 92,469,888	D145E	possibly damaging	Het
Neo1	T	A	9: 58,894,024		probably null	Het
Ninl	A	T	2: 150,949,781	S941T	probably benign	Het
Nrm	T	A	17: 35,861,519		probably null	Het
Nup214	T	C	2: 32,017,215	V1018A	possibly damaging	Het
Odf1	A	G	15: 38,219,472	I15V	probably benign	Het
Olfr1023	C	T	2: 85,886,994	H65Y	probably damaging	Het
Olfr118	T	A	17: 37,672,168	N48K	probably damaging	Het
Olfr1406	C	T	1: 173,183,891	R181H	probably benign	Het
Olfr32	T	A	2: 90,138,660	T160S	probably benign	Het
Olfr376	A	T	11: 73,374,884	N48I	probably damaging	Het
Olfr490	A	T	7: 108,286,691	V145D	probably benign	Het
Olfr670	A	T	7: 104,960,450	I94N	probably damaging	Het
Olfr850	C	A	9: 19,478,086	D55Y	probably benign	Het
Osgin2	A	T	4: 15,998,957	Y222N	probably damaging	Het
Pcdhga10	T	C	18: 37,749,310	V708A	probably benign	Het
Pfn3	T	C	13: 55,415,087	D27G	possibly damaging	Het
Plch2	A	G	4: 155,010,865		probably null	Het
Plin2	C	A	4: 86,658,677	Q270H	probably damaging	Het
Polk	A	G	13: 96,493,895	F386S	probably damaging	Het
Prkar1a	G	A	11: 109,665,952	G286E	probably damaging	Het
Prodh	A	T	16: 18,080,185	L276Q	probably damaging	Het
Ranbp10	T	C	8: 105,786,674	N202S	probably damaging	Het
Rnf144a	T	A	12: 26,327,575	K56N	probably benign	Het
Rpa1	T	A	11: 75,313,112	K303I	probably damaging	Het
Slc16a9	A	C	10: 70,282,510	N220H	possibly damaging	Het
Slc28a3	T	C	13: 58,576,850	I197V	probably benign	Het
Slc35d1	A	T	4: 103,214,749	F19I		Het
Sohlh2	A	T	3: 55,192,300	E164D	probably damaging	Het
Sord	A	T	2: 122,263,284	K295*	probably null	Het
Spata31d1b	A	G	13: 59,712,382	Y23C	probably benign	Het
Stard9	T	A	2: 120,679,936	Y333N	probably damaging	Het
Tas2r107	A	G	6: 131,659,790	F99L	probably damaging	Het
Thap12	C	T	7: 98,703,385		probably benign	Het
Tmprss9	A	T	10: 80,895,159	T840S	probably benign	Het
Trim16	T	A	11: 62,829,200		probably null	Het
Ttc16	C	T	2: 32,774,793		probably null	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Unc80	A	T	1: 66,612,212	Y1572F	possibly damaging	Het
Usp42	G	T	5: 143,720,305	A320D	possibly damaging	Het
Vmn2r94	T	C	17: 18,243,776	T751A	probably damaging	Het
Zbtb41	C	T	1: 139,440,346	L591F	probably damaging	Het
Zdhhc5	T	A	2: 84,694,318	E219D	probably damaging	Het
Zfp248	A	T	6: 118,429,051	F526I	probably damaging	Het
Zfp322a	T	C	13: 23,356,388	K395E	possibly damaging	Het
Zfp423	G	A	8: 87,780,249	P1156S	probably benign	Het
Zfp644	T	C	5: 106,638,265	T139A	possibly damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00
R9739:Rapgef6	UTSW	11	54622363	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GAGACTAGCAAATTTTAAGCAGTCCC -3'
(R):5'- TCCCACTAGCTCTTTGCATGAAG -3'

Sequencing Primer
(F):5'- GCACCATTTTTGTTTACTGAGATG -3'
(R):5'- GAGTCGTATGAGTTACATGGG -3'

Posted On

2022-11-14