Incidental Mutation 'R0961:Olfr130'
ID 81904
Institutional Source Beutler Lab
Gene Symbol Olfr130
Ensembl Gene ENSMUSG00000094878
Gene Name olfactory receptor 130
Synonyms GA_x6K02T2PSCP-2515350-2516303, MOR256-19
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R0961 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 38063921-38072790 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38067923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 251 (Y251N)
Ref Sequence ENSEMBL: ENSMUSP00000149601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087129] [ENSMUST00000215726] [ENSMUST00000217390]
AlphaFold Q8VFC1
Predicted Effect probably damaging
Transcript: ENSMUST00000087129
AA Change: Y251N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084369
Gene: ENSMUSG00000094878
AA Change: Y251N

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 223 1.9e-5 PFAM
Pfam:7tm_1 40 289 1.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215726
AA Change: Y251N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217390
AA Change: Y251N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Olfr130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr130 APN 17 38068095 missense probably benign
IGL02158:Olfr130 APN 17 38067267 missense probably damaging 0.97
IGL03172:Olfr130 APN 17 38067384 missense probably damaging 0.99
R0389:Olfr130 UTSW 17 38067671 missense possibly damaging 0.58
R0448:Olfr130 UTSW 17 38067672 missense probably benign 0.00
R0616:Olfr130 UTSW 17 38067240 missense probably damaging 1.00
R1789:Olfr130 UTSW 17 38067948 missense probably damaging 1.00
R2108:Olfr130 UTSW 17 38067855 missense possibly damaging 0.82
R4600:Olfr130 UTSW 17 38067962 missense probably damaging 0.99
R4977:Olfr130 UTSW 17 38067747 missense possibly damaging 0.67
R5120:Olfr130 UTSW 17 38067266 missense probably damaging 0.97
R5930:Olfr130 UTSW 17 38067750 missense probably benign 0.11
R6273:Olfr130 UTSW 17 38067795 missense probably damaging 1.00
R6636:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R6637:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R7030:Olfr130 UTSW 17 38068057 missense probably benign 0.13
R7045:Olfr130 UTSW 17 38067971 missense probably benign 0.01
R7175:Olfr130 UTSW 17 38067479 missense probably damaging 0.96
R7359:Olfr130 UTSW 17 38067615 nonsense probably null
R7762:Olfr130 UTSW 17 38067675 missense probably damaging 1.00
R7980:Olfr130 UTSW 17 38067521 missense possibly damaging 0.64
R8050:Olfr130 UTSW 17 38067479 missense probably damaging 1.00
R9035:Olfr130 UTSW 17 38067288 missense probably benign 0.00
X0019:Olfr130 UTSW 17 38067722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGCTATTCATGGCTTCCTTGG -3'
(R):5'- AGTGATTTCCTGGCTTGTAGCACTC -3'

Sequencing Primer
(F):5'- GGCTTCCTTGGTGCTGC -3'
(R):5'- GAGCATCTATCTCATGGTGAGCC -3'
Posted On 2013-11-08