Incidental Mutation 'R0961:Iqca'
ID81854
Institutional Source Beutler Lab
Gene Symbol Iqca
Ensembl Gene ENSMUSG00000026301
Gene NameIQ motif containing with AAA domain
Synonyms
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location90042132-90153401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90142731 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 133 (G133V)
Ref Sequence ENSEMBL: ENSMUSP00000108717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113094] [ENSMUST00000113094] [ENSMUST00000212394] [ENSMUST00000212394]
Predicted Effect probably null
Transcript: ENSMUST00000113094
AA Change: G133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: G133V

DomainStartEndE-ValueType
IQ 205 227 6.97e0 SMART
coiled coil region 340 380 N/A INTRINSIC
coiled coil region 425 450 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
AAA 567 706 1.08e-3 SMART
low complexity region 812 829 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113094
AA Change: G133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: G133V

DomainStartEndE-ValueType
IQ 205 227 6.97e0 SMART
coiled coil region 340 380 N/A INTRINSIC
coiled coil region 425 450 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
AAA 567 706 1.08e-3 SMART
low complexity region 812 829 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211999
Predicted Effect probably null
Transcript: ENSMUST00000212394
AA Change: G133V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably null
Transcript: ENSMUST00000212394
AA Change: G133V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1927 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Iqca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Iqca APN 1 90045657 missense probably benign 0.10
IGL01367:Iqca APN 1 90070628 splice site probably benign
IGL01545:Iqca APN 1 90045642 missense probably benign
IGL01797:Iqca APN 1 90144819 critical splice donor site probably null
IGL02098:Iqca APN 1 90047941 missense probably damaging 0.96
IGL02194:Iqca APN 1 90045663 missense probably benign 0.16
IGL03230:Iqca APN 1 90145002 missense probably damaging 1.00
IGL03259:Iqca APN 1 90052434 missense probably damaging 1.00
IGL03372:Iqca APN 1 90144969 missense possibly damaging 0.80
R0383:Iqca UTSW 1 90142707 missense probably damaging 1.00
R0610:Iqca UTSW 1 90142731 missense probably null 0.97
R0685:Iqca UTSW 1 90142731 missense probably null 0.97
R0798:Iqca UTSW 1 90142731 missense probably null 0.97
R0799:Iqca UTSW 1 90142731 missense probably null 0.97
R0800:Iqca UTSW 1 90142731 missense probably null 0.97
R0801:Iqca UTSW 1 90142731 missense probably null 0.97
R0825:Iqca UTSW 1 90142731 missense probably null 0.97
R0826:Iqca UTSW 1 90142731 missense probably null 0.97
R0827:Iqca UTSW 1 90142731 missense probably null 0.97
R0862:Iqca UTSW 1 90142731 missense probably null 0.97
R0863:Iqca UTSW 1 90142731 missense probably null 0.97
R0864:Iqca UTSW 1 90142731 missense probably null 0.97
R0960:Iqca UTSW 1 90142731 missense probably null 0.97
R0962:Iqca UTSW 1 90142731 missense probably null 0.97
R0963:Iqca UTSW 1 90142731 missense probably null 0.97
R1101:Iqca UTSW 1 90142731 missense probably null 0.97
R1344:Iqca UTSW 1 90142731 missense probably null 0.97
R1523:Iqca UTSW 1 90142731 missense probably null 0.97
R1646:Iqca UTSW 1 90140038 missense probably damaging 0.98
R1682:Iqca UTSW 1 90142731 missense probably null 0.97
R1742:Iqca UTSW 1 90098051 missense probably benign 0.01
R1774:Iqca UTSW 1 90080903 missense probably benign 0.02
R1775:Iqca UTSW 1 90081416 missense probably damaging 1.00
R2011:Iqca UTSW 1 90045626 missense probably benign 0.00
R2065:Iqca UTSW 1 90130231 missense probably benign 0.01
R2156:Iqca UTSW 1 90089516 missense possibly damaging 0.78
R2186:Iqca UTSW 1 90081344 missense probably benign 0.06
R3872:Iqca UTSW 1 90089481 missense probably damaging 1.00
R4308:Iqca UTSW 1 90144897 missense probably damaging 1.00
R4578:Iqca UTSW 1 90073750 missense probably damaging 0.98
R4737:Iqca UTSW 1 90077822 missense probably damaging 0.99
R4867:Iqca UTSW 1 90089504 missense probably benign 0.00
R4884:Iqca UTSW 1 90140037 missense probably benign 0.10
R4887:Iqca UTSW 1 90045701 missense probably damaging 1.00
R5352:Iqca UTSW 1 90130196 missense probably benign 0.00
R5733:Iqca UTSW 1 90070535 missense probably damaging 0.97
R5838:Iqca UTSW 1 90144945 missense probably benign 0.22
R5951:Iqca UTSW 1 90140097 intron probably null
R5957:Iqca UTSW 1 90080948 missense probably damaging 1.00
R6696:Iqca UTSW 1 90130200 missense probably benign
R7240:Iqca UTSW 1 90070550 missense possibly damaging 0.88
R7769:Iqca UTSW 1 90077810 missense possibly damaging 0.82
R7841:Iqca UTSW 1 90059615 missense
R7924:Iqca UTSW 1 90059615 missense
R8069:Iqca UTSW 1 90045744 missense probably damaging 0.96
Z1176:Iqca UTSW 1 90045725 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGCCCAAACGTTCCTTAATCCTGTC -3'
(R):5'- TCTGAACTGACCTCCCAAGCTGAC -3'

Sequencing Primer
(F):5'- CTAGACCTCATAGAGCAAGCGTG -3'
(R):5'- ccacaaacacccttacccac -3'
Posted On2013-11-08