Incidental Mutation 'R0974:Cxcl1'
ID83008
Institutional Source Beutler Lab
Gene Symbol Cxcl1
Ensembl Gene ENSMUSG00000029380
Gene Namechemokine (C-X-C motif) ligand 1
SynonymsKC/GRO-alpha, Scyb1, Gro1, Fsp, Mgsa, KC, N51
MMRRC Submission 039103-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R0974 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90891241-90893115 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 90891767 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 85 (K85*)
Ref Sequence ENSEMBL: ENSMUSP00000031327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031327]
Predicted Effect probably null
Transcript: ENSMUST00000031327
AA Change: K85*
SMART Domains Protein: ENSMUSP00000031327
Gene: ENSMUSG00000029380
AA Change: K85*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SCY 30 90 1.01e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201245
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. In mouse, deficiency of this gene is associated with colitis and with defects in immune cell recruitment to the lung. [provided by RefSeq, Apr 2013]
PHENOTYPE: Targeted mutations in this gene when combine with targeted mutation of Ldlr decreases susceptibility to atherosclerotic lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,926 probably null Het
5430419D17Rik T C 7: 131,238,182 L611P probably damaging Het
Adam18 T C 8: 24,647,853 T324A probably benign Het
AI429214 A G 8: 36,994,319 Q207R probably benign Het
Atp13a1 T C 8: 69,802,144 probably null Het
Atp6v0a1 T A 11: 101,055,491 L770* probably null Het
B3gnt5 T A 16: 19,770,010 D326E probably damaging Het
Btbd9 T A 17: 30,299,633 D451V probably damaging Het
Cd46 T C 1: 195,041,992 *366W probably null Het
Cenpc1 A T 5: 86,037,908 V248E probably damaging Het
Chd2 A G 7: 73,478,664 S858P probably damaging Het
Daam1 A C 12: 71,915,784 K90T unknown Het
Diexf A T 1: 193,114,703 N573K probably damaging Het
Dip2c G A 13: 9,576,908 A632T probably damaging Het
Dmtf1 T A 5: 9,127,987 I391F possibly damaging Het
Dnah14 T C 1: 181,752,145 V3081A probably damaging Het
Dnah9 A T 11: 66,005,837 probably null Het
Efemp1 A G 11: 28,854,538 E22G probably damaging Het
Ephb6 A G 6: 41,614,104 D65G probably damaging Het
Fsip2 A T 2: 82,977,092 T1252S probably benign Het
Golga4 T C 9: 118,537,273 I365T probably damaging Het
Gp2 A T 7: 119,454,543 L65Q probably damaging Het
Ice1 C A 13: 70,602,427 V1847L probably benign Het
Kbtbd7 A G 14: 79,427,430 E234G possibly damaging Het
Khsrp T C 17: 57,025,576 T235A probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Lrfn5 G A 12: 61,843,437 G504D probably damaging Het
Map6 G A 7: 99,336,743 G821D possibly damaging Het
Myh13 T A 11: 67,332,520 I222N probably damaging Het
Myh7b G A 2: 155,620,427 C350Y probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm3 C A 3: 115,101,986 S172R probably benign Het
Olfr1168 A T 2: 88,184,978 T34S probably benign Het
Olfr1231 A T 2: 89,303,184 I136N probably damaging Het
Olfr342 A G 2: 36,528,008 I199V probably benign Het
Olfr70 A G 4: 43,696,706 S156P probably damaging Het
Pacs1 A T 19: 5,143,829 D557E probably damaging Het
Phactr2 T C 10: 13,247,139 D343G possibly damaging Het
Pkd2l2 A G 18: 34,428,252 T438A probably damaging Het
Pld2 T C 11: 70,557,081 W857R probably damaging Het
Rilpl1 A G 5: 124,501,871 S156P probably benign Het
Rilpl1 A G 5: 124,501,888 I122T possibly damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Saxo2 A G 7: 82,634,870 V260A probably benign Het
Slc33a1 A G 3: 63,943,304 F533S probably benign Het
Slc38a4 C T 15: 97,005,858 V421M probably benign Het
Snx14 A G 9: 88,400,721 probably null Het
Sri A T 5: 8,059,381 Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Tm9sf1 T C 14: 55,642,935 T2A possibly damaging Het
Tmco5 A G 2: 116,883,218 T122A probably benign Het
Tmem59l G A 8: 70,486,060 P124S possibly damaging Het
Trpv6 T A 6: 41,625,188 T396S probably benign Het
Usp24 T A 4: 106,371,079 Y780* probably null Het
Usp24 A G 4: 106,413,678 probably null Het
Vmn2r53 A G 7: 12,601,392 F114L probably damaging Het
Zfp626 G A 7: 27,818,482 R296H probably damaging Het
Other mutations in Cxcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Cxcl1 APN 5 90891575 missense probably damaging 1.00
IGL01585:Cxcl1 APN 5 90891724 missense probably damaging 1.00
IGL01731:Cxcl1 APN 5 90891577 missense probably benign 0.02
R0973:Cxcl1 UTSW 5 90891767 nonsense probably null
R0973:Cxcl1 UTSW 5 90891767 nonsense probably null
R3118:Cxcl1 UTSW 5 90891595 critical splice donor site probably null
R5114:Cxcl1 UTSW 5 90891514 missense probably benign 0.00
R7111:Cxcl1 UTSW 5 90891323 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCAGAGCTTGAAGGTGTTGCCC -3'
(R):5'- GAACTGTTGCCACTGACCATTTGC -3'

Sequencing Primer
(F):5'- GAAGGTGTTGCCCTCAGG -3'
(R):5'- GCCACTGACCATTTGCATAGG -3'
Posted On2013-11-08