Incidental Mutation 'R0974:Tm9sf1'
ID 83042
Institutional Source Beutler Lab
Gene Symbol Tm9sf1
Ensembl Gene ENSMUSG00000002320
Gene Name transmembrane 9 superfamily member 1
Synonyms MP70, 1200014D02Rik
MMRRC Submission 039103-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R0974 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 55873422-55881263 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55880392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2 (T2A)
Ref Sequence ENSEMBL: ENSMUSP00000119435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000133707] [ENSMUST00000149726] [ENSMUST00000132338] [ENSMUST00000138085]
AlphaFold Q9DBU0
Predicted Effect probably benign
Transcript: ENSMUST00000002391
AA Change: T2A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120041
AA Change: T2A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121791
AA Change: T2A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121937
AA Change: T2A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122358
AA Change: T2A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127473
Predicted Effect possibly damaging
Transcript: ENSMUST00000133707
AA Change: T2A

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123471
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 118 1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149726
AA Change: T2A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132338
AA Change: T2A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138085
AA Change: T2A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119435
Gene: ENSMUSG00000002320
AA Change: T2A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 172 2.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228007
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.5%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,997 (GRCm39) probably null Het
Adam18 T C 8: 25,137,869 (GRCm39) T324A probably benign Het
AI429214 A G 8: 37,461,473 (GRCm39) Q207R probably benign Het
Atp13a1 T C 8: 70,254,794 (GRCm39) probably null Het
Atp6v0a1 T A 11: 100,946,317 (GRCm39) L770* probably null Het
B3gnt5 T A 16: 19,588,760 (GRCm39) D326E probably damaging Het
Btbd9 T A 17: 30,518,607 (GRCm39) D451V probably damaging Het
Cd46 T C 1: 194,724,300 (GRCm39) *366W probably null Het
Cdcp3 T C 7: 130,839,911 (GRCm39) L611P probably damaging Het
Cenpc1 A T 5: 86,185,767 (GRCm39) V248E probably damaging Het
Chd2 A G 7: 73,128,412 (GRCm39) S858P probably damaging Het
Cxcl1 A T 5: 91,039,626 (GRCm39) K85* probably null Het
Daam1 A C 12: 71,962,558 (GRCm39) K90T unknown Het
Dip2c G A 13: 9,626,944 (GRCm39) A632T probably damaging Het
Dmtf1 T A 5: 9,177,987 (GRCm39) I391F possibly damaging Het
Dnah14 T C 1: 181,579,710 (GRCm39) V3081A probably damaging Het
Dnah9 A T 11: 65,896,663 (GRCm39) probably null Het
Efemp1 A G 11: 28,804,538 (GRCm39) E22G probably damaging Het
Ephb6 A G 6: 41,591,038 (GRCm39) D65G probably damaging Het
Fsip2 A T 2: 82,807,436 (GRCm39) T1252S probably benign Het
Golga4 T C 9: 118,366,341 (GRCm39) I365T probably damaging Het
Gp2 A T 7: 119,053,766 (GRCm39) L65Q probably damaging Het
Ice1 C A 13: 70,750,546 (GRCm39) V1847L probably benign Het
Kbtbd7 A G 14: 79,664,870 (GRCm39) E234G possibly damaging Het
Khsrp T C 17: 57,332,576 (GRCm39) T235A probably benign Het
Klk13 T C 7: 43,370,582 (GRCm39) probably null Het
Lrfn5 G A 12: 61,890,223 (GRCm39) G504D probably damaging Het
Map6 G A 7: 98,985,950 (GRCm39) G821D possibly damaging Het
Myh13 T A 11: 67,223,346 (GRCm39) I222N probably damaging Het
Myh7b G A 2: 155,462,347 (GRCm39) C350Y probably benign Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm3 C A 3: 114,895,635 (GRCm39) S172R probably benign Het
Or13e8 A G 4: 43,696,706 (GRCm39) S156P probably damaging Het
Or1j14 A G 2: 36,418,020 (GRCm39) I199V probably benign Het
Or4c1 A T 2: 89,133,528 (GRCm39) I136N probably damaging Het
Or5d40 A T 2: 88,015,322 (GRCm39) T34S probably benign Het
Pacs1 A T 19: 5,193,857 (GRCm39) D557E probably damaging Het
Phactr2 T C 10: 13,122,883 (GRCm39) D343G possibly damaging Het
Pkd2l2 A G 18: 34,561,305 (GRCm39) T438A probably damaging Het
Pld2 T C 11: 70,447,907 (GRCm39) W857R probably damaging Het
Rilpl1 A G 5: 124,639,951 (GRCm39) I122T possibly damaging Het
Rilpl1 A G 5: 124,639,934 (GRCm39) S156P probably benign Het
Rims4 C T 2: 163,705,849 (GRCm39) V262M possibly damaging Het
Saxo2 A G 7: 82,284,078 (GRCm39) V260A probably benign Het
Slc33a1 A G 3: 63,850,725 (GRCm39) F533S probably benign Het
Slc38a4 C T 15: 96,903,739 (GRCm39) V421M probably benign Het
Snx14 A G 9: 88,282,774 (GRCm39) probably null Het
Sri A T 5: 8,109,381 (GRCm39) Q55L probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 54,879,857 (GRCm39) probably benign Het
Tmco5 A G 2: 116,713,699 (GRCm39) T122A probably benign Het
Tmem59l G A 8: 70,938,710 (GRCm39) P124S possibly damaging Het
Trpv6 T A 6: 41,602,122 (GRCm39) T396S probably benign Het
Usp24 T A 4: 106,228,276 (GRCm39) Y780* probably null Het
Usp24 A G 4: 106,270,875 (GRCm39) probably null Het
Utp25 A T 1: 192,797,011 (GRCm39) N573K probably damaging Het
Vmn2r53 A G 7: 12,335,319 (GRCm39) F114L probably damaging Het
Zfp626 G A 7: 27,517,907 (GRCm39) R296H probably damaging Het
Other mutations in Tm9sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Tm9sf1 APN 14 55,880,184 (GRCm39) missense probably damaging 1.00
IGL01102:Tm9sf1 APN 14 55,880,224 (GRCm39) missense probably damaging 1.00
IGL02263:Tm9sf1 APN 14 55,880,392 (GRCm39) missense possibly damaging 0.95
R0242:Tm9sf1 UTSW 14 55,875,392 (GRCm39) missense possibly damaging 0.90
R0242:Tm9sf1 UTSW 14 55,875,392 (GRCm39) missense possibly damaging 0.90
R0469:Tm9sf1 UTSW 14 55,878,886 (GRCm39) missense possibly damaging 0.87
R0928:Tm9sf1 UTSW 14 55,873,914 (GRCm39) missense probably damaging 1.00
R0973:Tm9sf1 UTSW 14 55,880,392 (GRCm39) missense possibly damaging 0.95
R0973:Tm9sf1 UTSW 14 55,880,392 (GRCm39) missense possibly damaging 0.95
R1441:Tm9sf1 UTSW 14 55,873,782 (GRCm39) missense probably damaging 1.00
R1644:Tm9sf1 UTSW 14 55,878,757 (GRCm39) missense probably benign 0.03
R1873:Tm9sf1 UTSW 14 55,873,680 (GRCm39) missense probably damaging 1.00
R2176:Tm9sf1 UTSW 14 55,878,866 (GRCm39) missense possibly damaging 0.89
R2973:Tm9sf1 UTSW 14 55,878,571 (GRCm39) missense probably benign 0.01
R4284:Tm9sf1 UTSW 14 55,878,780 (GRCm39) missense probably damaging 1.00
R4545:Tm9sf1 UTSW 14 55,875,565 (GRCm39) missense possibly damaging 0.74
R4633:Tm9sf1 UTSW 14 55,878,660 (GRCm39) missense probably damaging 1.00
R4816:Tm9sf1 UTSW 14 55,878,606 (GRCm39) missense possibly damaging 0.89
R4943:Tm9sf1 UTSW 14 55,878,625 (GRCm39) missense probably damaging 0.99
R5270:Tm9sf1 UTSW 14 55,873,938 (GRCm39) missense probably damaging 1.00
R5384:Tm9sf1 UTSW 14 55,880,301 (GRCm39) missense possibly damaging 0.80
R5385:Tm9sf1 UTSW 14 55,880,301 (GRCm39) missense possibly damaging 0.80
R5386:Tm9sf1 UTSW 14 55,880,301 (GRCm39) missense possibly damaging 0.80
R5561:Tm9sf1 UTSW 14 55,875,554 (GRCm39) missense probably damaging 1.00
R6246:Tm9sf1 UTSW 14 55,873,827 (GRCm39) missense probably damaging 1.00
R6247:Tm9sf1 UTSW 14 55,873,827 (GRCm39) missense probably damaging 1.00
R6248:Tm9sf1 UTSW 14 55,873,827 (GRCm39) missense probably damaging 1.00
R7319:Tm9sf1 UTSW 14 55,875,432 (GRCm39) unclassified probably benign
R7659:Tm9sf1 UTSW 14 55,873,792 (GRCm39) missense probably damaging 1.00
R7974:Tm9sf1 UTSW 14 55,873,906 (GRCm39) missense probably damaging 1.00
R9130:Tm9sf1 UTSW 14 55,875,464 (GRCm39) missense probably damaging 1.00
X0025:Tm9sf1 UTSW 14 55,880,293 (GRCm39) missense probably benign 0.43
X0026:Tm9sf1 UTSW 14 55,880,394 (GRCm39) start codon destroyed probably null 0.92
Predicted Primers PCR Primer
(F):5'- TTCTCAGGACAGCAGACTGGAAGC -3'
(R):5'- CGTTGCTATAGAAACGGGTTGGCAC -3'

Sequencing Primer
(F):5'- AAGCTGATAGTAGTGGTAAGTTTCC -3'
(R):5'- GGCCTAGAGGCGTGAAC -3'
Posted On 2013-11-08