Incidental Mutation 'R0909:Vsnl1'
ID83436
Institutional Source Beutler Lab
Gene Symbol Vsnl1
Ensembl Gene ENSMUSG00000054459
Gene Namevisinin-like 1
SynonymsVILIP
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R0909 (G1)
Quality Score150
Status Not validated
Chromosome12
Chromosomal Location11325242-11436613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11326371 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 171 (F171S)
Ref Sequence ENSEMBL: ENSMUSP00000152711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072299] [ENSMUST00000220506]
Predicted Effect probably damaging
Transcript: ENSMUST00000072299
AA Change: F171S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072145
Gene: ENSMUSG00000054459
AA Change: F171S

DomainStartEndE-ValueType
EFh 64 92 2.13e-5 SMART
EFh 100 128 5.24e-5 SMART
EFh 150 178 2.09e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220506
AA Change: F171S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The encoded protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Wbp2nl G A 15: 82,314,074 A271T probably benign Het
Other mutations in Vsnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Vsnl1 APN 12 11332189 missense probably damaging 0.96
IGL02285:Vsnl1 APN 12 11386877 missense probably damaging 1.00
IGL02610:Vsnl1 APN 12 11332071 nonsense probably null
PIT4696001:Vsnl1 UTSW 12 11326447 missense probably benign 0.23
R0055:Vsnl1 UTSW 12 11386986 splice site probably null
R0598:Vsnl1 UTSW 12 11386859 missense probably benign
R1444:Vsnl1 UTSW 12 11332218 critical splice acceptor site probably null
R4256:Vsnl1 UTSW 12 11332055 nonsense probably null
R6315:Vsnl1 UTSW 12 11332155 missense probably damaging 1.00
R6489:Vsnl1 UTSW 12 11332218 critical splice acceptor site probably benign
R6582:Vsnl1 UTSW 12 11326488 missense probably benign 0.01
R7422:Vsnl1 UTSW 12 11326438 missense probably benign 0.00
R7909:Vsnl1 UTSW 12 11326454 missense probably benign 0.00
R7919:Vsnl1 UTSW 12 11332086 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTACAGGAGAATGGTGACGCAGCC -3'
(R):5'- GAGACAAGCAGAGCAAACTCTCTGG -3'

Sequencing Primer
(F):5'- gtgtggggtgtggggtg -3'
(R):5'- AGAGCAAACTCTCTGGCTTCC -3'
Posted On2013-11-08