Incidental Mutation 'R0909:Wbp2nl'
ID83441
Institutional Source Beutler Lab
Gene Symbol Wbp2nl
Ensembl Gene ENSMUSG00000022455
Gene NameWBP2 N-terminal like
Synonyms4930521I23Rik, PAWP
MMRRC Submission 039067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0909 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82298954-82314623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82314074 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 271 (A271T)
Ref Sequence ENSEMBL: ENSMUSP00000023089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023089]
Predicted Effect probably benign
Transcript: ENSMUST00000023089
AA Change: A271T

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023089
Gene: ENSMUSG00000022455
AA Change: A271T

DomainStartEndE-ValueType
Pfam:GRAM 4 87 1e-9 PFAM
Pfam:WWbp 103 226 2e-23 PFAM
low complexity region 238 262 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WBP2NL is a sperm-specific WW domain-binding protein that promotes meiotic resumption and pronuclear development during oocyte fertilization (Wu et al., 2007 [PubMed 17289678]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit normal sperm morphology, acrosomal reaction, egg activation and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik T A 19: 3,715,788 M21K probably benign Het
Ap3s2 T C 7: 79,880,518 N183S probably benign Het
Cd109 A G 9: 78,636,473 I100V probably benign Het
Cep170b A G 12: 112,732,039 K77R probably null Het
Chmp5 C A 4: 40,960,968 N202K probably benign Het
Cnbd1 A T 4: 19,122,444 L15I probably benign Het
Ehmt2 T C 17: 34,906,504 V542A possibly damaging Het
Exosc9 A T 3: 36,554,704 I151F probably damaging Het
Eya2 A G 2: 165,754,493 N308S probably benign Het
Fbxw21 C A 9: 109,156,408 A101S possibly damaging Het
Frem3 A C 8: 80,663,406 N1762T probably benign Het
H2-DMb2 C A 17: 34,148,809 T68N probably benign Het
Hbs1l A G 10: 21,307,738 E126G probably benign Het
Lrrc2 T A 9: 110,962,673 probably null Het
Mrpl44 G A 1: 79,779,653 V272I probably benign Het
Msh4 G A 3: 153,863,504 L723F probably benign Het
Nemf T A 12: 69,341,610 D329V probably damaging Het
Noxa1 A T 2: 25,091,794 L99Q probably damaging Het
Nr6a1 A T 2: 38,885,206 D44E probably benign Het
Obscn T C 11: 59,075,064 D3131G probably damaging Het
Olfr551 A T 7: 102,588,447 C99S probably damaging Het
Olfr713 T C 7: 107,036,194 I13T probably benign Het
Olfr95 T G 17: 37,210,918 I312L probably benign Het
Pkhd1l1 T A 15: 44,538,883 probably null Het
Rbsn G A 6: 92,189,810 Q618* probably null Het
Rccd1 A C 7: 80,319,051 probably null Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Socs5 T A 17: 87,133,773 L47Q probably benign Het
Ttc16 T C 2: 32,762,868 T593A probably benign Het
Ube4a T C 9: 44,939,973 I748V probably damaging Het
Vipas39 T C 12: 87,241,331 D435G probably benign Het
Vmn2r69 C T 7: 85,406,665 G755D probably benign Het
Vsnl1 A G 12: 11,326,371 F171S probably damaging Het
Other mutations in Wbp2nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Wbp2nl APN 15 82314210 missense probably benign 0.03
IGL01074:Wbp2nl APN 15 82314290 missense possibly damaging 0.73
IGL01295:Wbp2nl APN 15 82306418 missense probably damaging 1.00
IGL01621:Wbp2nl APN 15 82308605 missense probably benign
IGL01735:Wbp2nl APN 15 82313816 missense probably benign
IGL01987:Wbp2nl APN 15 82308561 missense probably benign 0.03
IGL02426:Wbp2nl APN 15 82306173 missense probably damaging 1.00
IGL02900:Wbp2nl APN 15 82313834 missense probably benign
IGL02971:Wbp2nl APN 15 82305744 missense possibly damaging 0.61
R0194:Wbp2nl UTSW 15 82314282 missense possibly damaging 0.93
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R0242:Wbp2nl UTSW 15 82313787 missense probably benign
R1442:Wbp2nl UTSW 15 82314206 missense probably benign
R1753:Wbp2nl UTSW 15 82305744 missense probably damaging 0.97
R4085:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4086:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4087:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R4726:Wbp2nl UTSW 15 82306054 missense probably damaging 1.00
R4840:Wbp2nl UTSW 15 82314336 missense possibly damaging 0.96
R6338:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6339:Wbp2nl UTSW 15 82299045 missense possibly damaging 0.94
R6820:Wbp2nl UTSW 15 82313795 missense possibly damaging 0.65
R7156:Wbp2nl UTSW 15 82305702 missense probably damaging 1.00
R7323:Wbp2nl UTSW 15 82314341 makesense probably null
R7598:Wbp2nl UTSW 15 82308561 missense probably benign 0.07
R7857:Wbp2nl UTSW 15 82306072 missense probably benign 0.24
R7903:Wbp2nl UTSW 15 82306131 nonsense probably null
Z1177:Wbp2nl UTSW 15 82308564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGATGTCCTGCCTCCTGGATAC -3'
(R):5'- TGGTTCCACCCTGTGACTAAACTCC -3'

Sequencing Primer
(F):5'- CCTGGATACGGAGCTGTGAG -3'
(R):5'- GTGATCAGATACCTAAGTGTTCCG -3'
Posted On2013-11-08