Incidental Mutation 'R1023:Mef2b'
ID 94632
Institutional Source Beutler Lab
Gene Symbol Mef2b
Ensembl Gene ENSMUSG00000079033
Gene Name myocyte enhancer factor 2B
Synonyms
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1023 (G1)
Quality Score 162
Status Validated
Chromosome 8
Chromosomal Location 70139711-70167488 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70165597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 109 (P109L)
Ref Sequence ENSEMBL: ENSMUSP00000132314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110140] [ENSMUST00000110141] [ENSMUST00000110143] [ENSMUST00000110146] [ENSMUST00000163756]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110140
AA Change: P109L

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105767
Gene: ENSMUSG00000079033
AA Change: P109L

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110141
AA Change: P109L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105768
Gene: ENSMUSG00000079033
AA Change: P109L

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110143
AA Change: P109L

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105770
Gene: ENSMUSG00000079033
AA Change: P109L

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110146
AA Change: P109L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105773
Gene: ENSMUSG00000079033
AA Change: P109L

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163756
AA Change: P109L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033
AA Change: P109L

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Meta Mutation Damage Score 0.0924 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (GeneID 729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as GeneID 4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on GeneID 4207. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Mef2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Mef2b UTSW 8 70164260 missense probably damaging 1.00
R4091:Mef2b UTSW 8 70165102 missense probably damaging 1.00
R4162:Mef2b UTSW 8 70166311 missense probably damaging 1.00
R4562:Mef2b UTSW 8 70167268 missense probably damaging 1.00
R4950:Mef2b UTSW 8 70167196 missense probably damaging 1.00
R5318:Mef2b UTSW 8 70166843 missense probably damaging 0.99
R5752:Mef2b UTSW 8 70165617 missense possibly damaging 0.77
R6126:Mef2b UTSW 8 70166876 missense probably benign 0.01
R6279:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6300:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6332:Mef2b UTSW 8 70164139 splice site probably null
R6369:Mef2b UTSW 8 70165559 missense probably benign 0.05
R6873:Mef2b UTSW 8 70166307 missense probably benign 0.29
R7266:Mef2b UTSW 8 70164288 missense probably damaging 1.00
R9638:Mef2b UTSW 8 70166856 frame shift probably null
X0022:Mef2b UTSW 8 70166834 missense probably benign 0.41
Z1176:Mef2b UTSW 8 70166375 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACTTGAACTTCAGGGGAACTCAC -3'
(R):5'- ATCCAGGACAAGACTGGCTTCCAC -3'

Sequencing Primer
(F):5'- GAACTCACAGTGGTTTTAGTCC -3'
(R):5'- AGACTGGCTTCCACGAAGTG -3'
Posted On 2014-01-05