Mutagenetix > Incidental Mutation

Incidental Mutation 'R1023:Ap3d1'

94644

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

039125-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R1023 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80714258 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 713 (L713Q)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000020420] [ENSMUST00000218610]

AlphaFold

O54774

Predicted Effect

probably damaging
Transcript: ENSMUST00000020420
AA Change: L713Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: L713Q

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000020420
AA Change: L713Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: L713Q

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219253

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220183

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,066,871	A607V	probably damaging	Het
4930523C07Rik	A	G	1: 160,077,487		probably benign	Het
Baz2a	A	G	10: 128,121,807	T1010A	possibly damaging	Het
Cd163l1	T	A	7: 140,224,463	C484S	possibly damaging	Het
Cdh15	T	C	8: 122,865,200	I608T	probably damaging	Het
Cdkl2	A	T	5: 92,039,286	D40E	possibly damaging	Het
Col9a2	G	A	4: 121,044,010	G118R	unknown	Het
Cryge	C	A	1: 65,050,786	C79F	probably damaging	Het
Dapk1	T	C	13: 60,730,985	L596P	probably damaging	Het
Dqx1	G	A	6: 83,061,089	C486Y	probably damaging	Het
Enam	A	G	5: 88,501,967	Q445R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gnpat	A	T	8: 124,870,780	D27V	probably benign	Het
Htr5a	A	T	5: 27,842,998	T184S	possibly damaging	Het
Lap3	C	T	5: 45,495,211	P50S	probably benign	Het
Mamdc2	A	T	19: 23,310,907	M589K	probably damaging	Het
Mast4	A	G	13: 102,735,496	S2263P	probably benign	Het
Mef2b	C	T	8: 70,165,597	P109L	possibly damaging	Het
Meltf	T	A	16: 31,884,960	F168L	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Nup205	T	A	6: 35,234,706	F1661I	probably damaging	Het
Olfr187	A	T	16: 59,035,815	N307K	probably benign	Het
Olfr747	A	T	14: 50,681,016	L206H	probably damaging	Het
Plac8	A	T	5: 100,556,581	D83E	probably benign	Het
Pnpt1	T	C	11: 29,141,328		probably benign	Het
Pold2	G	T	11: 5,875,140	Q86K	probably benign	Het
Ptprt	A	G	2: 161,558,943	L1057P	probably damaging	Het
Rev3l	A	G	10: 39,832,639	H2284R	probably damaging	Het
Skint6	A	C	4: 113,238,103	S120A	probably benign	Het
Slc1a7	G	A	4: 108,007,573	V270M	probably damaging	Het
Spata2	A	G	2: 167,485,222	M85T	probably benign	Het
Taf1b	G	T	12: 24,509,559		probably benign	Het
Tert	A	G	13: 73,642,059	N844S	probably benign	Het
Thrap3	G	A	4: 126,180,089	S288L	possibly damaging	Het
Ubap2l	A	G	3: 90,047,873		probably benign	Het
Ubtf	T	C	11: 102,311,450	E197G	possibly damaging	Het
Usp20	G	T	2: 31,007,813	G216W	probably damaging	Het
Wdr60	T	C	12: 116,232,657	E490G	probably damaging	Het
Yy1	T	A	12: 108,793,531	V40E	unknown	Het
Zfp335	G	A	2: 164,892,585	H1254Y	possibly damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
Particle	UTSW	10	80710494	splice site	probably null
vesicle	UTSW	10	80723827	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
R8896:Ap3d1	UTSW	10	80716591	missense	probably benign	0.01
R8936:Ap3d1	UTSW	10	80712118	missense	probably benign	0.02
R9183:Ap3d1	UTSW	10	80709793	missense	probably null	0.06
R9209:Ap3d1	UTSW	10	80719084	missense	probably benign	0.04
R9259:Ap3d1	UTSW	10	80723827	missense	probably damaging	1.00
R9476:Ap3d1	UTSW	10	80709821	missense	probably benign	0.00
R9645:Ap3d1	UTSW	10	80709228	missense	probably benign
R9664:Ap3d1	UTSW	10	80712805	missense	possibly damaging	0.71
R9781:Ap3d1	UTSW	10	80709775	missense	possibly damaging	0.51
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GAGAAGGCACTAACCTCTGGCATC -3'
(R):5'- CTTCCTCACAACTGTATGACAGGGC -3'

Sequencing Primer
(F):5'- cttctccttcttcttccttttcttg -3'
(R):5'- TGCAGCTTACCTTATGGGCAG -3'

Posted On

2014-01-05