Incidental Mutation 'R1023:Pnpt1'
ID94651
Institutional Source Beutler Lab
Gene Symbol Pnpt1
Ensembl Gene ENSMUSG00000020464
Gene Namepolyribonucleotide nucleotidyltransferase 1
SynonymsPNPase, polynucleotide phosphorylase, 1200003F12Rik
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29130744-29161828 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 29141328 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020756]
PDB Structure
Solution structure of the alpha-helical domain from mouse hypothetical PNPase [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020756
SMART Domains Protein: ENSMUSP00000020756
Gene: ENSMUSG00000020464

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
Pfam:RNase_PH 52 183 1.9e-16 PFAM
Pfam:RNase_PH_C 186 251 3.8e-13 PFAM
Pfam:PNPase 282 363 3.7e-9 PFAM
Pfam:RNase_PH 366 501 3.4e-22 PFAM
Pfam:RNase_PH_C 504 581 7.1e-6 PFAM
KH 604 669 8e-7 SMART
S1 677 750 2.15e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154924
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved polynucleotide phosphorylase family comprised of phosphate dependent 3'-to-5' exoribonucleases implicated in RNA processing and degradation. This enzyme is predominantly localized in the mitochondrial intermembrane space and is involved in import of RNA to mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency-13 and autosomal recessive nonsyndromic deafness-70. Related pseudogenes are found on chromosomes 3 and 7. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality and impaired mitochondrial RNA import. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Pnpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pnpt1 APN 11 29154217 critical splice donor site probably null
IGL00920:Pnpt1 APN 11 29157087 splice site probably benign
IGL01358:Pnpt1 APN 11 29138425 missense possibly damaging 0.95
IGL01454:Pnpt1 APN 11 29137142 missense probably benign 0.19
IGL01622:Pnpt1 APN 11 29148272 splice site probably benign
IGL01623:Pnpt1 APN 11 29148272 splice site probably benign
IGL01674:Pnpt1 APN 11 29155787 missense probably benign 0.00
IGL01802:Pnpt1 APN 11 29154306 missense probably damaging 1.00
IGL02222:Pnpt1 APN 11 29159327 missense possibly damaging 0.71
IGL02222:Pnpt1 APN 11 29130842 missense probably benign 0.00
IGL02616:Pnpt1 APN 11 29135505 splice site probably benign
IGL02859:Pnpt1 APN 11 29138162 missense probably damaging 1.00
IGL02965:Pnpt1 APN 11 29156939 missense probably damaging 0.98
IGL03121:Pnpt1 APN 11 29132845 missense probably benign 0.03
PIT4651001:Pnpt1 UTSW 11 29156945 critical splice donor site probably null
R1477:Pnpt1 UTSW 11 29137102 missense probably benign 0.14
R1524:Pnpt1 UTSW 11 29130776 missense unknown
R1769:Pnpt1 UTSW 11 29154159 missense probably benign 0.22
R1839:Pnpt1 UTSW 11 29154342 missense possibly damaging 0.82
R1975:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1977:Pnpt1 UTSW 11 29141256 missense probably benign 0.16
R1996:Pnpt1 UTSW 11 29141679 missense probably benign 0.01
R3771:Pnpt1 UTSW 11 29138174 missense probably benign 0.05
R4346:Pnpt1 UTSW 11 29145478 missense probably damaging 1.00
R4423:Pnpt1 UTSW 11 29153375 intron probably null
R5354:Pnpt1 UTSW 11 29154166 missense probably damaging 1.00
R5503:Pnpt1 UTSW 11 29138156 missense probably damaging 1.00
R5514:Pnpt1 UTSW 11 29153246 missense possibly damaging 0.82
R5908:Pnpt1 UTSW 11 29130887 missense probably benign 0.00
R6225:Pnpt1 UTSW 11 29145469 missense probably benign 0.38
R6605:Pnpt1 UTSW 11 29138567 missense possibly damaging 0.69
R7096:Pnpt1 UTSW 11 29154867 missense probably benign 0.03
R7214:Pnpt1 UTSW 11 29137285 missense probably damaging 1.00
R7365:Pnpt1 UTSW 11 29161334 missense probably damaging 1.00
R7492:Pnpt1 UTSW 11 29135522 missense probably benign 0.01
R7497:Pnpt1 UTSW 11 29130860 missense probably benign 0.00
R7686:Pnpt1 UTSW 11 29157070 missense probably damaging 0.97
Z1176:Pnpt1 UTSW 11 29145475 missense probably benign 0.00
Z1176:Pnpt1 UTSW 11 29145477 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GAGCAAGCCAAATGCCTATAACTGC -3'
(R):5'- TGGGTTCCACTCTAAGTCCCACTG -3'

Sequencing Primer
(F):5'- AAATGTTTGACTGTCTCCATTGGC -3'
(R):5'- ccactctaagtcccactgaatcC -3'
Posted On2014-01-05