Mutagenetix > Incidental Mutation

Incidental Mutation 'R1023:Pnpt1'

94651

Institutional Source

Beutler Lab

Gene Symbol

Pnpt1

Ensembl Gene

ENSMUSG00000020464

Gene Name

polyribonucleotide nucleotidyltransferase 1

Synonyms

PNPase, polynucleotide phosphorylase, 1200003F12Rik

MMRRC Submission

039125-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1023 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29130744-29161828 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 29141328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000020756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020756]

AlphaFold

Q8K1R3

PDB Structure

Solution structure of the alpha-helical domain from mouse hypothetical PNPase [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000020756

SMART Domains

Protein: ENSMUSP00000020756
Gene: ENSMUSG00000020464

Domain	Start	End	E-Value	Type
low complexity region	4	26	N/A	INTRINSIC
Pfam:RNase_PH	52	183	1.9e-16	PFAM
Pfam:RNase_PH_C	186	251	3.8e-13	PFAM
Pfam:PNPase	282	363	3.7e-9	PFAM
Pfam:RNase_PH	366	501	3.4e-22	PFAM
Pfam:RNase_PH_C	504	581	7.1e-6	PFAM
KH	604	669	8e-7	SMART
S1	677	750	2.15e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131527

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154924

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved polynucleotide phosphorylase family comprised of phosphate dependent 3'-to-5' exoribonucleases implicated in RNA processing and degradation. This enzyme is predominantly localized in the mitochondrial intermembrane space and is involved in import of RNA to mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency-13 and autosomal recessive nonsyndromic deafness-70. Related pseudogenes are found on chromosomes 3 and 7. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality and impaired mitochondrial RNA import. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,066,871	A607V	probably damaging	Het
4930523C07Rik	A	G	1: 160,077,487		probably benign	Het
Ap3d1	A	T	10: 80,714,258	L713Q	probably damaging	Het
Baz2a	A	G	10: 128,121,807	T1010A	possibly damaging	Het
Cd163l1	T	A	7: 140,224,463	C484S	possibly damaging	Het
Cdh15	T	C	8: 122,865,200	I608T	probably damaging	Het
Cdkl2	A	T	5: 92,039,286	D40E	possibly damaging	Het
Col9a2	G	A	4: 121,044,010	G118R	unknown	Het
Cryge	C	A	1: 65,050,786	C79F	probably damaging	Het
Dapk1	T	C	13: 60,730,985	L596P	probably damaging	Het
Dqx1	G	A	6: 83,061,089	C486Y	probably damaging	Het
Enam	A	G	5: 88,501,967	Q445R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gnpat	A	T	8: 124,870,780	D27V	probably benign	Het
Htr5a	A	T	5: 27,842,998	T184S	possibly damaging	Het
Lap3	C	T	5: 45,495,211	P50S	probably benign	Het
Mamdc2	A	T	19: 23,310,907	M589K	probably damaging	Het
Mast4	A	G	13: 102,735,496	S2263P	probably benign	Het
Mef2b	C	T	8: 70,165,597	P109L	possibly damaging	Het
Meltf	T	A	16: 31,884,960	F168L	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Nup205	T	A	6: 35,234,706	F1661I	probably damaging	Het
Olfr187	A	T	16: 59,035,815	N307K	probably benign	Het
Olfr747	A	T	14: 50,681,016	L206H	probably damaging	Het
Plac8	A	T	5: 100,556,581	D83E	probably benign	Het
Pold2	G	T	11: 5,875,140	Q86K	probably benign	Het
Ptprt	A	G	2: 161,558,943	L1057P	probably damaging	Het
Rev3l	A	G	10: 39,832,639	H2284R	probably damaging	Het
Skint6	A	C	4: 113,238,103	S120A	probably benign	Het
Slc1a7	G	A	4: 108,007,573	V270M	probably damaging	Het
Spata2	A	G	2: 167,485,222	M85T	probably benign	Het
Taf1b	G	T	12: 24,509,559		probably benign	Het
Tert	A	G	13: 73,642,059	N844S	probably benign	Het
Thrap3	G	A	4: 126,180,089	S288L	possibly damaging	Het
Ubap2l	A	G	3: 90,047,873		probably benign	Het
Ubtf	T	C	11: 102,311,450	E197G	possibly damaging	Het
Usp20	G	T	2: 31,007,813	G216W	probably damaging	Het
Wdr60	T	C	12: 116,232,657	E490G	probably damaging	Het
Yy1	T	A	12: 108,793,531	V40E	unknown	Het
Zfp335	G	A	2: 164,892,585	H1254Y	possibly damaging	Het

Other mutations in Pnpt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Pnpt1	APN	11	29154217	critical splice donor site	probably null
IGL00920:Pnpt1	APN	11	29157087	splice site	probably benign
IGL01358:Pnpt1	APN	11	29138425	missense	possibly damaging	0.95
IGL01454:Pnpt1	APN	11	29137142	missense	probably benign	0.19
IGL01622:Pnpt1	APN	11	29148272	splice site	probably benign
IGL01623:Pnpt1	APN	11	29148272	splice site	probably benign
IGL01674:Pnpt1	APN	11	29155787	missense	probably benign	0.00
IGL01802:Pnpt1	APN	11	29154306	missense	probably damaging	1.00
IGL02222:Pnpt1	APN	11	29159327	missense	possibly damaging	0.71
IGL02222:Pnpt1	APN	11	29130842	missense	probably benign	0.00
IGL02616:Pnpt1	APN	11	29135505	splice site	probably benign
IGL02859:Pnpt1	APN	11	29138162	missense	probably damaging	1.00
IGL02965:Pnpt1	APN	11	29156939	missense	probably damaging	0.98
IGL03121:Pnpt1	APN	11	29132845	missense	probably benign	0.03
PIT4651001:Pnpt1	UTSW	11	29156945	critical splice donor site	probably null
R1477:Pnpt1	UTSW	11	29137102	missense	probably benign	0.14
R1524:Pnpt1	UTSW	11	29130776	missense	unknown
R1769:Pnpt1	UTSW	11	29154159	missense	probably benign	0.22
R1839:Pnpt1	UTSW	11	29154342	missense	possibly damaging	0.82
R1975:Pnpt1	UTSW	11	29141256	missense	probably benign	0.16
R1977:Pnpt1	UTSW	11	29141256	missense	probably benign	0.16
R1996:Pnpt1	UTSW	11	29141679	missense	probably benign	0.01
R3771:Pnpt1	UTSW	11	29138174	missense	probably benign	0.05
R4346:Pnpt1	UTSW	11	29145478	missense	probably damaging	1.00
R4423:Pnpt1	UTSW	11	29153375	splice site	probably null
R5354:Pnpt1	UTSW	11	29154166	missense	probably damaging	1.00
R5503:Pnpt1	UTSW	11	29138156	missense	probably damaging	1.00
R5514:Pnpt1	UTSW	11	29153246	missense	possibly damaging	0.82
R5908:Pnpt1	UTSW	11	29130887	missense	probably benign	0.00
R6225:Pnpt1	UTSW	11	29145469	missense	probably benign	0.38
R6605:Pnpt1	UTSW	11	29138567	missense	possibly damaging	0.69
R7096:Pnpt1	UTSW	11	29154867	missense	probably benign	0.03
R7214:Pnpt1	UTSW	11	29137285	missense	probably damaging	1.00
R7365:Pnpt1	UTSW	11	29161334	missense	probably damaging	1.00
R7492:Pnpt1	UTSW	11	29135522	missense	probably benign	0.01
R7497:Pnpt1	UTSW	11	29130860	missense	probably benign	0.00
R7686:Pnpt1	UTSW	11	29157070	missense	probably damaging	0.97
R8166:Pnpt1	UTSW	11	29156875	missense	probably benign
R8309:Pnpt1	UTSW	11	29153277	missense	probably benign	0.01
R8389:Pnpt1	UTSW	11	29130758	start codon destroyed	unknown
R8542:Pnpt1	UTSW	11	29132773	splice site	probably null
R8737:Pnpt1	UTSW	11	29154815	critical splice acceptor site	probably null
R8876:Pnpt1	UTSW	11	29146769	intron	probably benign
R9308:Pnpt1	UTSW	11	29147535	critical splice donor site	probably null
R9545:Pnpt1	UTSW	11	29156840	missense	probably benign	0.13
Z1176:Pnpt1	UTSW	11	29145475	missense	probably benign	0.00
Z1176:Pnpt1	UTSW	11	29145477	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GAGCAAGCCAAATGCCTATAACTGC -3'
(R):5'- TGGGTTCCACTCTAAGTCCCACTG -3'

Sequencing Primer
(F):5'- AAATGTTTGACTGTCTCCATTGGC -3'
(R):5'- ccactctaagtcccactgaatcC -3'

Posted On

2014-01-05