Incidental Mutation 'R1023:Olfr747'
ID 94668
Institutional Source Beutler Lab
Gene Symbol Olfr747
Ensembl Gene ENSMUSG00000057179
Gene Name olfactory receptor 747
Synonyms GA_x6K02T2PMLR-6420220-6419279, MOR106-7, MOR106-16
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R1023 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 50680657-50693206 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 50681016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 206 (L206H)
Ref Sequence ENSEMBL: ENSMUSP00000149081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078075] [ENSMUST00000205373] [ENSMUST00000205897] [ENSMUST00000213238]
AlphaFold E9PXH6
Predicted Effect probably damaging
Transcript: ENSMUST00000078075
AA Change: L206H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077220
Gene: ENSMUSG00000057179
AA Change: L206H

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-53 PFAM
Pfam:7tm_1 40 289 2.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205373
AA Change: L206H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000205897
Predicted Effect probably damaging
Transcript: ENSMUST00000213238
AA Change: L206H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.5065 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Olfr747
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Olfr747 APN 14 50681200 missense probably benign 0.04
R0349:Olfr747 UTSW 14 50681254 missense probably benign 0.00
R0613:Olfr747 UTSW 14 50681404 missense probably benign 0.06
R1126:Olfr747 UTSW 14 50681263 missense possibly damaging 0.94
R1298:Olfr747 UTSW 14 50680880 nonsense probably null
R1344:Olfr747 UTSW 14 50680858 missense probably benign
R1775:Olfr747 UTSW 14 50681166 missense possibly damaging 0.66
R1928:Olfr747 UTSW 14 50681415 missense probably benign 0.00
R2208:Olfr747 UTSW 14 50681563 missense probably benign 0.01
R4181:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4183:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R4184:Olfr747 UTSW 14 50681050 missense probably benign 0.07
R5104:Olfr747 UTSW 14 50680702 nonsense probably null
R6144:Olfr747 UTSW 14 50680935 missense probably benign 0.01
R6768:Olfr747 UTSW 14 50681592 missense probably damaging 1.00
R7026:Olfr747 UTSW 14 50681259 missense probably damaging 0.98
R7454:Olfr747 UTSW 14 50680824 missense possibly damaging 0.94
R7777:Olfr747 UTSW 14 50680804 missense probably damaging 1.00
R7851:Olfr747 UTSW 14 50681458 missense probably damaging 1.00
R8427:Olfr747 UTSW 14 50681149 missense probably damaging 0.99
X0067:Olfr747 UTSW 14 50681529 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACTTTCCTCAGAGCAAGTTTCATGTCC -3'
(R):5'- GTCTCTTCCTGGCAGTAATGGCTTATG -3'

Sequencing Primer
(F):5'- CATGTCCTTGTTACGAAGGC -3'
(R):5'- CCTACTATCATGACTAGGAGGCTG -3'
Posted On 2014-01-05