Incidental Mutation 'R1035:Fam98b'
ID95503
Institutional Source Beutler Lab
Gene Symbol Fam98b
Ensembl Gene ENSMUSG00000027349
Gene Namefamily with sequence similarity 98, member B
Synonyms
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R1035 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location117249739-117271540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117270639 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 311 (R311W)
Ref Sequence ENSEMBL: ENSMUSP00000028825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028825]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028825
AA Change: R311W

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028825
Gene: ENSMUSG00000027349
AA Change: R311W

DomainStartEndE-ValueType
Pfam:DUF2465 17 331 2e-135 PFAM
Meta Mutation Damage Score 0.1824 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Caskin1 A G 17: 24,505,037 N933S probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Fam98b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Fam98b APN 2 117260312 missense probably benign 0.34
IGL03175:Fam98b APN 2 117259238 missense probably benign 0.24
R0384:Fam98b UTSW 2 117267847 missense possibly damaging 0.95
R2207:Fam98b UTSW 2 117267819 missense probably damaging 1.00
R3121:Fam98b UTSW 2 117267927 missense probably damaging 0.98
R4273:Fam98b UTSW 2 117260231 missense possibly damaging 0.81
R5276:Fam98b UTSW 2 117259298 missense possibly damaging 0.94
R5325:Fam98b UTSW 2 117270651 missense possibly damaging 0.91
R5460:Fam98b UTSW 2 117259256 missense probably damaging 1.00
R5616:Fam98b UTSW 2 117267786 missense possibly damaging 0.92
R5627:Fam98b UTSW 2 117267933 missense probably damaging 1.00
R6787:Fam98b UTSW 2 117262921 critical splice donor site probably null
R7252:Fam98b UTSW 2 117263892 missense probably damaging 1.00
R7502:Fam98b UTSW 2 117263863 missense probably damaging 1.00
R8182:Fam98b UTSW 2 117249821 missense probably damaging 1.00
R8272:Fam98b UTSW 2 117262854 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGTACCTCGGAATGCAGTCTTC -3'
(R):5'- TAATCGCCCCTGCCTTGGAAAC -3'

Sequencing Primer
(F):5'- CGGAATGCAGTCTTCTTTGATAACC -3'
(R):5'- ccctcccccaccacttc -3'
Posted On2014-01-05