Mutagenetix > Incidental Mutation

Incidental Mutation 'R1035:Vmn2r98'

95573

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r98

Ensembl Gene

ENSMUSG00000096717

Gene Name

vomeronasal 2, receptor 98

Synonyms

EG224552

MMRRC Submission

039134-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R1035 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19053460-19082411 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19080749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 671 (I671T)

Ref Sequence

ENSEMBL: ENSMUSP00000131261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170424]

AlphaFold

E9PZ56

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170424
AA Change: I671T

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: I671T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	460	2.6e-35	PFAM
Pfam:NCD3G	509	562	7.4e-22	PFAM
Pfam:7tm_3	594	830	1.4e-52	PFAM
low complexity region	844	856	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 94.9%
20x: 88.4%

Validation Efficiency

97% (36/37)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,876,283	T174M	probably damaging	Het
Ap3b2	A	T	7: 81,463,911	L850Q	unknown	Het
Asxl3	T	C	18: 22,525,049	S2039P	probably damaging	Het
Cadm2	A	T	16: 66,815,347	M109K	probably damaging	Het
Caskin1	A	G	17: 24,505,037	N933S	probably damaging	Het
Cbln4	T	C	2: 172,042,069	N77S	possibly damaging	Het
Chek1	A	G	9: 36,716,473	I256T	probably damaging	Het
Col5a3	A	T	9: 20,793,499		probably benign	Het
Cyp2b10	C	T	7: 25,917,048	S360L	probably benign	Het
Dctn1	T	C	6: 83,190,220	S222P	probably damaging	Het
Dnah7b	A	G	1: 46,124,448	I471V	probably benign	Het
Ear2	A	T	14: 44,102,887	M1L	possibly damaging	Het
Entpd6	T	A	2: 150,764,192		probably benign	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Fam98b	C	T	2: 117,270,639	R311W	possibly damaging	Het
Ggt7	A	T	2: 155,506,427	C102S	probably damaging	Het
Myo15	T	C	11: 60,510,558		probably benign	Het
Nlrp9c	C	T	7: 26,371,277		probably benign	Het
Nrxn1	A	T	17: 90,163,874	N1234K	probably damaging	Het
Olfr201	C	T	16: 59,268,944	C241Y	probably damaging	Het
Pcsk1	T	C	13: 75,132,119	S688P	probably benign	Het
Polr1a	T	C	6: 71,967,916	F1319L	probably benign	Het
Ppig	T	C	2: 69,749,459	Y446H	unknown	Het
Stk17b	T	C	1: 53,762,599	T88A	probably benign	Het
Tas2r143	A	T	6: 42,400,265	I10F	probably benign	Het
Theg	G	A	10: 79,583,850	T182M	probably damaging	Het
Tmprss12	G	A	15: 100,285,200	R141Q	probably benign	Het
Trpa1	A	G	1: 14,891,303		probably null	Het
Txndc16	A	G	14: 45,172,563	S187P	possibly damaging	Het
Zfp78	G	T	7: 6,378,661	V237F	probably damaging	Het

Other mutations in Vmn2r98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r98	APN	17	19065745	splice site	probably benign
IGL01296:Vmn2r98	APN	17	19065185	missense	probably damaging	1.00
IGL01363:Vmn2r98	APN	17	19065758	missense	probably benign	0.01
IGL01618:Vmn2r98	APN	17	19065259	missense	possibly damaging	0.93
IGL01746:Vmn2r98	APN	17	19066451	missense	probably damaging	1.00
IGL01747:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01770:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01868:Vmn2r98	APN	17	19066286	missense	probably benign
IGL02123:Vmn2r98	APN	17	19080679	missense	probably damaging	1.00
IGL02323:Vmn2r98	APN	17	19065851	missense	probably damaging	0.99
IGL02543:Vmn2r98	APN	17	19065821	missense	probably benign
IGL02650:Vmn2r98	APN	17	19080961	missense	probably benign	0.00
IGL02676:Vmn2r98	APN	17	19065259	missense	probably benign	0.00
IGL02803:Vmn2r98	APN	17	19066013	missense	probably benign
IGL02807:Vmn2r98	APN	17	19081021	missense	probably damaging	1.00
IGL03307:Vmn2r98	APN	17	19065980	missense	possibly damaging	0.62
IGL03396:Vmn2r98	APN	17	19069845	missense	possibly damaging	0.92
PIT4131001:Vmn2r98	UTSW	17	19080961	missense	probably benign	0.00
R0122:Vmn2r98	UTSW	17	19066400	missense	probably benign	0.06
R0329:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0330:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0368:Vmn2r98	UTSW	17	19065827	nonsense	probably null
R0545:Vmn2r98	UTSW	17	19053613	missense	probably benign	0.15
R0635:Vmn2r98	UTSW	17	19080497	missense	probably benign	0.00
R0689:Vmn2r98	UTSW	17	19080520	missense	possibly damaging	0.83
R1243:Vmn2r98	UTSW	17	19065948	missense	possibly damaging	0.52
R1421:Vmn2r98	UTSW	17	19065178	missense	probably damaging	1.00
R1629:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R1643:Vmn2r98	UTSW	17	19080908	missense	probably damaging	1.00
R1795:Vmn2r98	UTSW	17	19066440	missense	probably damaging	1.00
R1958:Vmn2r98	UTSW	17	19066418	missense	possibly damaging	0.70
R1962:Vmn2r98	UTSW	17	19065333	nonsense	probably null
R2165:Vmn2r98	UTSW	17	19081291	missense	unknown
R2238:Vmn2r98	UTSW	17	19065951	missense	probably damaging	1.00
R2252:Vmn2r98	UTSW	17	19080436	missense	probably benign	0.00
R2323:Vmn2r98	UTSW	17	19065819	missense	probably benign	0.18
R2887:Vmn2r98	UTSW	17	19081177	missense	possibly damaging	0.83
R2909:Vmn2r98	UTSW	17	19067402	missense	probably damaging	1.00
R3001:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3002:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3003:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3788:Vmn2r98	UTSW	17	19080625	missense	probably benign	0.31
R4570:Vmn2r98	UTSW	17	19066092	missense	probably benign	0.11
R4706:Vmn2r98	UTSW	17	19069745	missense	probably damaging	1.00
R4723:Vmn2r98	UTSW	17	19066340	missense	probably benign	0.01
R5036:Vmn2r98	UTSW	17	19066157	missense	probably benign	0.00
R5072:Vmn2r98	UTSW	17	19066044	missense	probably benign	0.07
R5121:Vmn2r98	UTSW	17	19053553	missense	probably benign	0.13
R5283:Vmn2r98	UTSW	17	19080719	missense	probably benign	0.05
R5294:Vmn2r98	UTSW	17	19069754	nonsense	probably null
R5371:Vmn2r98	UTSW	17	19069753	missense	probably damaging	1.00
R5532:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R5598:Vmn2r98	UTSW	17	19080899	missense	probably benign	0.37
R5800:Vmn2r98	UTSW	17	19065998	missense	probably benign	0.17
R6089:Vmn2r98	UTSW	17	19066074	missense	probably benign	0.29
R6155:Vmn2r98	UTSW	17	19065881	missense	possibly damaging	0.87
R6853:Vmn2r98	UTSW	17	19065801	missense	probably benign	0.00
R6920:Vmn2r98	UTSW	17	19065248	missense	probably damaging	0.98
R7012:Vmn2r98	UTSW	17	19066268	missense	probably benign	0.06
R7042:Vmn2r98	UTSW	17	19080922	missense	probably benign
R7068:Vmn2r98	UTSW	17	19065313	missense	probably benign
R7607:Vmn2r98	UTSW	17	19067308	missense	possibly damaging	0.95
R7763:Vmn2r98	UTSW	17	19080535	missense	probably benign	0.00
R7771:Vmn2r98	UTSW	17	19067198	splice site	probably null
R7915:Vmn2r98	UTSW	17	19067231	missense	probably benign	0.10
R8028:Vmn2r98	UTSW	17	19053650	missense	probably benign	0.00
R8205:Vmn2r98	UTSW	17	19081163	missense	probably damaging	0.99
R8241:Vmn2r98	UTSW	17	19080769	missense	probably damaging	0.99
R8906:Vmn2r98	UTSW	17	19066270	missense	probably benign
R8952:Vmn2r98	UTSW	17	19065269	missense	possibly damaging	0.76
R9147:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9148:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9187:Vmn2r98	UTSW	17	19081219	missense	probably damaging	1.00
R9344:Vmn2r98	UTSW	17	19066515	missense	probably benign	0.14
R9467:Vmn2r98	UTSW	17	19067255	missense	probably benign	0.01
R9487:Vmn2r98	UTSW	17	19081234	missense	possibly damaging	0.78
R9753:Vmn2r98	UTSW	17	19065403	missense	probably benign	0.27
Z1177:Vmn2r98	UTSW	17	19065136	critical splice acceptor site	probably null
Z1177:Vmn2r98	UTSW	17	19067423	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTTCTGGCCTATGAAGACCCCTTG -3'
(R):5'- TGAATGGTGGAGATGTTGCCATCC -3'

Sequencing Primer
(F):5'- GAGACACTCCTATTGTCAAGGC -3'
(R):5'- GGAGATGTTGCCATCCATATTC -3'

Posted On

2014-01-05