Incidental Mutation 'R1035:Caskin1'
ID95575
Institutional Source Beutler Lab
Gene Symbol Caskin1
Ensembl Gene ENSMUSG00000033597
Gene NameCASK interacting protein 1
SynonymsC630036E02Rik, 3300002N10Rik
MMRRC Submission 039134-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1035 (G1)
Quality Score103
Status Validated
Chromosome17
Chromosomal Location24488783-24508905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24505037 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 933 (N933S)
Ref Sequence ENSEMBL: ENSMUSP00000024958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958] [ENSMUST00000070777] [ENSMUST00000088464] [ENSMUST00000176086] [ENSMUST00000176353] [ENSMUST00000176652] [ENSMUST00000176668]
Predicted Effect probably damaging
Transcript: ENSMUST00000024958
AA Change: N933S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597
AA Change: N933S

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070777
SMART Domains Protein: ENSMUSP00000069334
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088464
SMART Domains Protein: ENSMUSP00000085812
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Pfam:zf-TRAF 221 277 3.4e-8 PFAM
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176353
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176652
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177024
Meta Mutation Damage Score 0.0725 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Ap3b2 A T 7: 81,463,911 L850Q unknown Het
Asxl3 T C 18: 22,525,049 S2039P probably damaging Het
Cadm2 A T 16: 66,815,347 M109K probably damaging Het
Cbln4 T C 2: 172,042,069 N77S possibly damaging Het
Chek1 A G 9: 36,716,473 I256T probably damaging Het
Col5a3 A T 9: 20,793,499 probably benign Het
Cyp2b10 C T 7: 25,917,048 S360L probably benign Het
Dctn1 T C 6: 83,190,220 S222P probably damaging Het
Dnah7b A G 1: 46,124,448 I471V probably benign Het
Ear2 A T 14: 44,102,887 M1L possibly damaging Het
Entpd6 T A 2: 150,764,192 probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam98b C T 2: 117,270,639 R311W possibly damaging Het
Ggt7 A T 2: 155,506,427 C102S probably damaging Het
Myo15 T C 11: 60,510,558 probably benign Het
Nlrp9c C T 7: 26,371,277 probably benign Het
Nrxn1 A T 17: 90,163,874 N1234K probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Pcsk1 T C 13: 75,132,119 S688P probably benign Het
Polr1a T C 6: 71,967,916 F1319L probably benign Het
Ppig T C 2: 69,749,459 Y446H unknown Het
Stk17b T C 1: 53,762,599 T88A probably benign Het
Tas2r143 A T 6: 42,400,265 I10F probably benign Het
Theg G A 10: 79,583,850 T182M probably damaging Het
Tmprss12 G A 15: 100,285,200 R141Q probably benign Het
Trpa1 A G 1: 14,891,303 probably null Het
Txndc16 A G 14: 45,172,563 S187P possibly damaging Het
Vmn2r98 T C 17: 19,080,749 I671T possibly damaging Het
Zfp78 G T 7: 6,378,661 V237F probably damaging Het
Other mutations in Caskin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Caskin1 APN 17 24503889 missense probably damaging 1.00
IGL00846:Caskin1 APN 17 24499349 critical splice donor site probably null
IGL01120:Caskin1 APN 17 24505369 missense possibly damaging 0.56
IGL01543:Caskin1 APN 17 24504548 missense probably benign
IGL01622:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL01623:Caskin1 APN 17 24503940 critical splice donor site probably null
IGL02120:Caskin1 APN 17 24500942 missense probably damaging 1.00
IGL02816:Caskin1 APN 17 24502170 missense probably benign 0.06
IGL02898:Caskin1 APN 17 24502409 missense probably benign 0.00
IGL03353:Caskin1 APN 17 24499357 splice site probably benign
PIT4151001:Caskin1 UTSW 17 24502219 missense probably damaging 1.00
PIT4453001:Caskin1 UTSW 17 24499292 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0057:Caskin1 UTSW 17 24504896 missense probably damaging 1.00
R0190:Caskin1 UTSW 17 24504622 missense possibly damaging 0.92
R0443:Caskin1 UTSW 17 24505400 missense probably damaging 0.96
R0885:Caskin1 UTSW 17 24505694 missense probably damaging 1.00
R1253:Caskin1 UTSW 17 24505073 missense probably damaging 1.00
R1497:Caskin1 UTSW 17 24504541 nonsense probably null
R1589:Caskin1 UTSW 17 24505478 splice site probably null
R1651:Caskin1 UTSW 17 24502212 missense possibly damaging 0.82
R1944:Caskin1 UTSW 17 24500771 missense probably damaging 0.99
R1969:Caskin1 UTSW 17 24506850 missense possibly damaging 0.94
R2057:Caskin1 UTSW 17 24496459 missense probably damaging 0.99
R2127:Caskin1 UTSW 17 24496996 critical splice donor site probably null
R2158:Caskin1 UTSW 17 24505154 missense probably benign
R2402:Caskin1 UTSW 17 24503808 missense probably damaging 1.00
R2895:Caskin1 UTSW 17 24489042 missense probably damaging 1.00
R3423:Caskin1 UTSW 17 24499565 missense probably damaging 0.98
R3800:Caskin1 UTSW 17 24501272 missense probably benign
R4108:Caskin1 UTSW 17 24502147 missense probably benign
R4419:Caskin1 UTSW 17 24504709 missense probably damaging 1.00
R4510:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4511:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4552:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4638:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4642:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4644:Caskin1 UTSW 17 24506628 missense probably benign 0.11
R4824:Caskin1 UTSW 17 24501129 missense probably benign 0.01
R4882:Caskin1 UTSW 17 24504415 missense probably damaging 1.00
R4964:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R4966:Caskin1 UTSW 17 24507161 missense probably damaging 1.00
R5809:Caskin1 UTSW 17 24504547 missense probably benign 0.06
R5841:Caskin1 UTSW 17 24496209 missense probably damaging 0.99
R5877:Caskin1 UTSW 17 24505265 missense possibly damaging 0.69
R5960:Caskin1 UTSW 17 24498895 missense probably benign 0.31
R5994:Caskin1 UTSW 17 24496961 missense probably damaging 0.98
R6022:Caskin1 UTSW 17 24496735 missense probably benign 0.37
R6209:Caskin1 UTSW 17 24507121 missense possibly damaging 0.84
R6228:Caskin1 UTSW 17 24507180 missense probably damaging 0.99
R6287:Caskin1 UTSW 17 24496709 missense probably damaging 1.00
R6497:Caskin1 UTSW 17 24504548 missense probably benign
R6873:Caskin1 UTSW 17 24504179 missense probably benign 0.31
R7079:Caskin1 UTSW 17 24498884 missense probably benign 0.31
R7156:Caskin1 UTSW 17 24500683 splice site probably null
R7385:Caskin1 UTSW 17 24503924 missense probably damaging 1.00
R7953:Caskin1 UTSW 17 24504221 missense probably damaging 1.00
R7993:Caskin1 UTSW 17 24499305 nonsense probably null
X0022:Caskin1 UTSW 17 24505166 missense probably benign 0.34
X0063:Caskin1 UTSW 17 24507182 missense probably damaging 1.00
Z1176:Caskin1 UTSW 17 24505038 missense probably damaging 1.00
Z1177:Caskin1 UTSW 17 24496687 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTGAATCGCTATGCAGCATCCGAC -3'
(R):5'- TGTGCTTCACAGAGGCCAACAC -3'

Sequencing Primer
(F):5'- TATGCAGCATCCGACAGTGAG -3'
(R):5'- AACATGGCTGCGATGCTC -3'
Posted On2014-01-05