Phenotypic Mutation 'giant' (pdf version)
List |< first << previous [record 29 of 74] next >> last >|
Allelegiant
Mutation Type critical splice donor site
Chromosome4
Coordinate101,765,152 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Lepr
Gene Name leptin receptor
Synonym(s) obl, Leprb, Obr, obese-like, OB-RGRP, Modb1, leptin receptor gene-related protein, LEPROT
Chromosomal Location 101,717,404-101,815,352 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_146146, NM_010704, NM_001122899; MGI:104993

Mapped Yes 
Limits of the Critical Region 101717404 - 101815352 bp
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000037385] [ENSMUSP00000099838] [ENSMUSP00000102534]
SMART Domains Protein: ENSMUSP00000037385
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 328 418 6.3e-23 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
low complexity region 908 921 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000099838
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000102534
Gene: ENSMUSG00000057722

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
FN3 236 315 1.5e-5 SMART
Pfam:Lep_receptor_Ig 329 420 2.6e-29 PFAM
FN3 535 618 4.93e-1 SMART
FN3 641 721 3.25e1 SMART
FN3 736 818 2.35e0 SMART
transmembrane domain 838 860 N/A INTRINSIC
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased 5918576
Body Weight (Male) - increased 5918576
growth/size 5918576
NK cell response - decreased
NK killing - decreased
TLR signaling defect: hyposensitivity to CpG + IFNg
total IgE level - increased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(53) : Chemically induced (ENU)(9) Chemically induced (other)(2) Radiation induced(1) Spontaneous(15) Targeted(23) Transgenic(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lepr APN 4 101815035 missense probably benign
IGL01111:Lepr APN 4 101814655 missense possibly damaging 0.77
IGL01324:Lepr APN 4 101768068 missense probably benign 0.23
IGL01372:Lepr APN 4 101735577 missense possibly damaging 0.67
IGL01626:Lepr APN 4 101733534 missense probably benign 0.10
IGL01733:Lepr APN 4 101765082 missense probably benign 0.00
IGL01815:Lepr APN 4 101814790 missense possibly damaging 0.49
IGL01899:Lepr APN 4 101779987 missense possibly damaging 0.86
IGL02138:Lepr APN 4 101768067 missense probably damaging 0.98
IGL02161:Lepr APN 4 101745678 missense probably damaging 0.97
IGL02653:Lepr APN 4 101764944 missense probably benign 0.44
IGL02735:Lepr APN 4 101782638 missense probably damaging 1.00
IGL03035:Lepr APN 4 101764980 missense probably damaging 1.00
IGL03083:Lepr APN 4 101814679 nonsense probably null
IGL03160:Lepr APN 4 101764906 missense probably damaging 1.00
business_class UTSW 4 101764872 nonsense
cherub UTSW 4 101768063 nonsense
fluffy UTSW 4 101792023 missense probably damaging 1.00
odd UTSW 4 101728075 splice donor site
paleo UTSW 4 101745645 missense possibly damaging 0.94
well-upholstered UTSW 4 101772959 nonsense
R0140:Lepr UTSW 4 101768067 missense probably damaging 1.00
R0197:Lepr UTSW 4 101752152 missense possibly damaging 0.64
R0279:Lepr UTSW 4 101750344 missense probably benign 0.05
R0487:Lepr UTSW 4 101768093 nonsense probably null
R0498:Lepr UTSW 4 101745692 missense probably benign 0.01
R0506:Lepr UTSW 4 101773010 splice site probably benign
R0512:Lepr UTSW 4 101792019 missense probably damaging 1.00
R0512:Lepr UTSW 4 101814704 missense possibly damaging 0.87
R0726:Lepr UTSW 4 101764934 missense probably benign 0.01
R1054:Lepr UTSW 4 101782596 missense probably damaging 0.97
R1109:Lepr UTSW 4 101771355 missense probably damaging 1.00
R1398:Lepr UTSW 4 101792019 missense probably damaging 1.00
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1464:Lepr UTSW 4 101735681 missense probably benign 0.08
R1519:Lepr UTSW 4 101789344 missense probably damaging 0.97
R1602:Lepr UTSW 4 101745645 missense possibly damaging 0.94
R1830:Lepr UTSW 4 101735677 missense probably damaging 1.00
R1850:Lepr UTSW 4 101733423 missense possibly damaging 0.67
R1918:Lepr UTSW 4 101772836 missense probably benign 0.08
R1928:Lepr UTSW 4 101782730 splice site probably benign
R2099:Lepr UTSW 4 101772988 missense probably damaging 1.00
R2102:Lepr UTSW 4 101772981 missense possibly damaging 0.95
R2175:Lepr UTSW 4 101765379 missense probably benign 0.01
R2254:Lepr UTSW 4 101815112 missense probably benign 0.26
R2396:Lepr UTSW 4 101733528 missense probably benign 0.19
R2508:Lepr UTSW 4 101790896 missense probably damaging 0.98
R2571:Lepr UTSW 4 101768172 missense possibly damaging 0.96
R3790:Lepr UTSW 4 101790914 splice site probably benign
R3882:Lepr UTSW 4 101815265 missense probably damaging 1.00
R3933:Lepr UTSW 4 101765301 splice site probably benign
R4211:Lepr UTSW 4 101733414 missense probably benign 0.19
R4343:Lepr UTSW 4 101765152 critical splice donor site probably null
R4345:Lepr UTSW 4 101765152 critical splice donor site probably null
R4544:Lepr UTSW 4 101768228 missense possibly damaging 0.96
R4546:Lepr UTSW 4 101814641 missense probably benign 0.35
R4724:Lepr UTSW 4 101765365 nonsense probably null
R4797:Lepr UTSW 4 101780047 missense possibly damaging 0.90
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4860:Lepr UTSW 4 101789337 missense probably benign 0.14
R4929:Lepr UTSW 4 101815117 missense probably benign 0.00
R4939:Lepr UTSW 4 101733438 missense possibly damaging 0.78
R5377:Lepr UTSW 4 101815019 missense possibly damaging 0.71
R5520:Lepr UTSW 4 101745537 missense probably benign 0.00
R5966:Lepr UTSW 4 101792127 intron probably benign
R6092:Lepr UTSW 4 101792023 missense probably damaging 1.00
R6130:Lepr UTSW 4 101765372 missense probably damaging 0.99
R6168:Lepr UTSW 4 101735592 missense probably damaging 0.99
R6232:Lepr UTSW 4 101814391 intron probably null
R6380:Lepr UTSW 4 101764954 nonsense probably null
R6427:Lepr UTSW 4 101774257 missense possibly damaging 0.47
R6428:Lepr UTSW 4 101780098 missense probably damaging 1.00
R6641:Lepr UTSW 4 101765305 missense probably damaging 0.97
R6650:Lepr UTSW 4 101815201 missense probably damaging 1.00
R6859:Lepr UTSW 4 101765290 splice site probably null
X0026:Lepr UTSW 4 101733327 missense possibly damaging 0.47
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-05-22 9:02 AM by Anne Murray
Record Created 2016-07-27 6:52 PM by Jin Huk Choi
Record Posted 2016-09-15
Phenotypic Description
Figure 1. The giant mice (top) exhibit increased body weights compared to wild-type littermates (bottom).
Figure 2. Homozygous giant mice exhibit increased body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous giant mice exhibit hyperglycemia 30 minutes after glucose treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Homozygous giant mice exhibit increased IgE levels in the peripheral blood. IgE levels were measured by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Homozygous giant mice exhibit reduced killing of natural killer target cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The giant phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R4345, some of which showed increased body weights (Figure 1 & 2), increased blood glucose levels 30 minutes after glucose bolus (Figure 3), increased levels of IgE levels in the peripheral blood (Figure 4), and reduced killing of natural killer target cells (Figure 5) compared to wild-type mice. 

Nature of Mutation

Figure 6. Linkage mapping of the increased body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R4345. Scaled body weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Lepr:  a G to A transition at base pair 101,765,152 (v38) on chromosome 4, or base pair 48,019 in the GenBank genomic region NC_000070 within the donor splice site on intron 8 of the Lepr gene. The strongest association was found with a recessive model of linkage to the body weight phenotype, wherein two variant homozygotes departed phenotypically from six homozygous reference mice and 15 heterozygous mice with a P value of 1.213 x 10-17 (Figure 6). 

 

The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 291-nucleotide exon 8 (out of 19 total exons), resulting in an in-frame deletion of 97 amino acids beginning after amino acid 329 of the encoded protein.

 
               <--exon 7          <--exon 8 intron 8-->       exon 9-->               <--exon 19
35057 ……GTCTTTACCACACAAG ……GAATTATACGTGATCG gtaagaatcccaagg…… ATGTCAATATCAAT…… ……GACTTAACTGTGTAA 98122
325   ……-V--F--T--T--Q-- ……-E--L--Y--V--I--                   D--V--N--I--N-…… ……-D--L--T--V--*- 1162

            correct            deleted                                     correct

 

The donor splice site of intron 8, which is destroyed by the giant mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 7. Domain of OB-Rb and structure of mouse leptin receptor isoforms. OB-Rb contains the longest intracellular domain, which is crucial for leptin signaling. OB-Ra, OB-Rc and OB-Rd have varying short cytoplasmic domains. All isoforms contain the Box 1 motif known to bind JAK kinases. OB-Re is a secreted isoform of the leptin receptor. Cytokine receptor homology module (CRH)2 is the main binding site for leptin. The immunoglobin-like (IG-like) and fibronectin type III (FNIII) domains are involved in OB-R activation. The role of CRH1 remains to be determined. Both CRH domains also contain a FNIII fold (see text). The giant mutation s a donor splice site mutation in intron 8 that is predicted to result in the in-frame deletion of exon 8. Exon 8 encodes amino acids 330-426, which encompasses the Ig-like fold domain. This image is interactive. Other mutations found in the Lepr gene are noted in red. Click on the mutations for more specific information. 

The Lepr or obr gene encodes an 1162 amino acid protein that is the receptor for leptin, a four-helical cytokine-like hormone produced primarily by adipocytes [Figure 7; (1;2)]. The leptin receptor is a member of the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT (signal transducer and activator of transcription) proteins (see domino for more information on STAT signaling). Six isoforms of the leptin receptor are generated by alternative splicing; each isoform, with the exception of a soluble isoform (OB-Re) are single-pass membrane-spanning proteins differing only in the sequences of their C-terminal intracellular domains. The extracellular portion of the human leptin receptor contains two CK domains that contain conserved cysteine-containing motifs (amino acids 62-178 and amino acids 428-535), four domains that contain a fibronectin type III (FNIII) fold (amino acids 235-327, 536-635, 636-731, and amino acids 732-841), and a domain that has an Ig-like fold (amino acids 328-427). The first CK domain and the first FNIII domain form the cytokine receptor homology module 1 (CRH1), while the second CK domain and remaining FNIII domains form the cytokine receptor homology module 2. 

 

The giant mutation is a donor splice site mutation in intron 8 that is predicted to result in the in-frame deletion of exon 8. Exon 8 encodes amino acids 330-426, which encompasses the Ig-like fold domain.

 

Please see the record for Business class for more information on Lepr.

Putative Mechanism

Leptin, a systemic hormone, regulates multiple functions of the body including energy utilization and storage, various endocrine axes, bone metabolism, thermoregulation, angiogenesis, immunity and inflammation by binding to the long form of the leptin receptor (OB-Rb) and subsequent initiation of various signal transduction pathways [reviewed in (3-5)].  It is primarily produced by adipocytes in proportion to fat stores, but can also be produced by placenta (syncytiotrophoblasts), ovaries, skeletal muscle, stomach, mammary epithelial cells, bone marrow, pituitary and liver (6). Humans and other animals deficient for leptin or its receptor, exhibit hyperphagia and low metabolism that results in obesity and insulin resistance [OMIM #614963; (2;7;8)].  Similar to other Lepr mouse models (see MGI for a list of Lepr alleles as well as the entry for Business_class), the giant mice exhibit obesity. The phenotype of the giant mice indicates that the LepRgiant protein exhibits loss of function.

Primers PCR Primer
giant(F):5'- AGGAATCTAGCTGAGAAAATCCCTG -3'
giant(R):5'- GTGCTTCCCACTAGTGATTGG -3'

Sequencing Primer
giant_seq(F):5'- CCCTGAGATACAGTACAGCATTGTG -3'
giant_seq(R):5'- AAGTACCCGTCAGTTTCACATG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJin Huk Choi, Tao Yue, Evan Nair-Gill, and Bruce Beutler
List |< first << previous [record 29 of 74] next >> last >|