Phenotypic Mutation 'shenandoah2' (pdf version)
Alleleshenandoah2
Mutation Type missense
Chromosome7
Coordinate43,412,017 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Siglecg
Gene Name sialic acid binding Ig-like lectin G
Synonym(s) mSiglec-G, A630096C01Rik
Chromosomal Location 43,408,204-43,418,358 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_172900; MGI:2443630

Mapped Yes 
Amino Acid Change Asparagine changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000005592]
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: N481K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect possibly damaging

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
(Using ENSMUST00000005592)
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B1 cells - increased 17572677
FACS CD4:CD8 - increased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD8+ T cells in CD3+ T cells - decreased
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(6) : Gene trapped(3) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43409057 missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43411795 missense probably benign 0.02
IGL01806:Siglecg APN 7 43411464 splice site probably null
IGL01947:Siglecg APN 7 43408763 missense probably benign 0.43
IGL02257:Siglecg APN 7 43411904 missense probably benign 0.00
IGL02410:Siglecg APN 7 43408829 missense probably damaging 0.99
IGL02454:Siglecg APN 7 43408895 missense probably benign 0.00
Chamonix UTSW 7 43409422 missense possibly damaging 0.91
Montblanc UTSW 7 43411386 intron probably benign
Shenandoah UTSW 7 43408802 missense probably damaging 0.99
Sherando UTSW 7 43409057 missense possibly damaging 0.64
IGL02988:Siglecg UTSW 7 43418052 missense probably damaging 1.00
R0134:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0225:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0480:Siglecg UTSW 7 43411126 missense probably benign 0.42
R1538:Siglecg UTSW 7 43417889 missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43408941 missense probably benign 0.17
R2358:Siglecg UTSW 7 43409422 missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43417908 missense probably benign 0.03
R4754:Siglecg UTSW 7 43411871 intron probably benign
R5017:Siglecg UTSW 7 43411386 intron probably benign
R5713:Siglecg UTSW 7 43408802 missense probably damaging 0.99
R5777:Siglecg UTSW 7 43409413 missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43412204 intron probably benign
R6153:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43408754 missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43409057 missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43408979 missense probably benign 0.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-02-11 5:44 PM by Diantha La Vine
Record Created 2018-04-05 9:48 AM by Bruce Beutler
Record Posted 2018-07-30
Phenotypic Description

Figure 1. Shenandoah2 mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Shenandoah2 mice exhibit increased CD4+ to CD8+ T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Shenandoah2 mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Shenandoah2 mice exhibit reduced frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The shenandoah2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6153, some of which showed increased frequencies of B1 cells in the peripheral blood (Figure 1) as well as increased CD4+ to CD8+ T cell ratios (Figure 2) due to increased frequencies of CD4+ T cells in CD3+ T cells (Figure 3) with concomitant reduced frequencies of CD8+ T cells in CD3+ T cells (Figure 4) in the peripheral blood.

Nature of Mutation

Figure 5. Linkage mapping of the increased B1 cell frequency phenotype using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R6153. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Siglecg:  a C to A transversion at base pair 43,412,017 (v38) on chromosome 7, or base pair 3,825 in the GenBank genomic region NC_000073. The strongest association was found with a recessive model of inheritance to the increased B1 cell frequency phenotype, wherein six variant homozygotes departed phenotypically from nine homozygous reference mice and 20 heterozygous mice with a P value of 2.939 x 10-13 (Figure 5). 

 

The mutation corresponds to residue 1,588 in the mRNA sequence NM_172900 within exon 9 of 12 total exons.

 

1571 GGGCTGCTGGAGGGGAACAGCAGCAATGCCTCC
476  -G--L--L--E--G--N--S--S--N--A--S-

 

The mutated nucleotide is indicated in red. The mutation results in an asparagine to lysine substitution at position 481 (N481K) in the Siglec-G protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.819).

Protein Prediction
Figure 6. Domain organization of Siglec-G. The shenandoah2 mutation results in an asparagine to lysine substitution at position 481. Other mutations found in the Siglec-G protein are shown in red. Click on each mutation for more information.

Siglec-G (Siglec-10 in humans) is a member of the CD33-related Siglec (sialic acid–binding immunoglobulin‐like lectin) family of adhesion molecules. Siglecs specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates; Siglec-G preferentially binds α2,3-linked or α2,6-linked sialic acid (α2,3Sia or α2,6Sia).

 

Siglec-C is a type 1 transmembrane protein with a signal peptide, a sialic-binding V-set Ig-like domain, three C2-set Ig-like domains, a transmembrane domain, and a cytoplasmic tail with two putative immune receptor tyrosine-based inhibitory motifs (ITIMs) and a Grb-2 binding motif (Figure 6) (1).

 

The shenandoah2 mutation results in an asparagine to lysine substitution at position 481 (N481K) in the Siglec-G protein; amino acid 481 is within an undefined region in the extracellular N-terminal tail.

 

For more information about Siglecg, please see the record Shenandoah.

Putative Mechanism

Siglec-G/-10 is one of two Siglecs expressed by B cells (the other being CD22; see the record for well), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed by (2)]. Siglec-G/-10 is a B1 cell inhibitory receptor that inhibits B cell receptor-associated NF-κB and calcium signaling, subsequently controlling the expansion and survival of B1 cells (1;3-5). The mechanism by which Siglec-G/-10 functions as an inhibitory receptor is unknown.

 

Siglecg-/- mice have increased levels of serum IgM and produce more IgM autoantibodies than wild-type mice (1;3). Over time, the Siglecg-/- mice develop B-cell lymphoproliferative disorders, including diffuse large B-cell lymphoma, follicular lymphoma, medium-to-large B-cell monomorphic lymphoma and atypical lymphoproliferations (6). Older Siglecg-/- mice also exhibited an autoimmune phenotype with increased autoantibody levels and mild glomerulonephritis as well as increased numbers of plasma cells, germinal center B cells, and activated CD4 T cells (7;8).

 

Siglecg-/- mice exhibited increased numbers of B-1 (B-1a and B-1b) B cells due to reduced spontaneous apoptosis and increased life spans of the cells (1;3-5).

 

The phenotype of the shenandoah2 mice indicate loss of Siglec-Gshenandoah2 function.

Primers PCR Primer
shenandoah2(F):5'- CTCTCTGTGCACTGTGAGTAGG -3'
shenandoah2(R):5'- TAGCGAATCTTAGTCCCAAAAGGG -3'

Sequencing Primer
shenandoah2_seq(F):5'- CTGTGCACTGTGAGTAGGCAAAG -3'
shenandoah2_seq(R):5'- TCCTTTACCAGGTAGCAG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, Evan Nair-Gill, and Bruce Beutler