Phenotypic Mutation 'Sherando'

• Allele: Sherando
• Mutation Type: missense
• Chromosome: 7
• Coordinate: 43,409,057 bp (GRCm38)
• Base Change: A ⇒ G (forward strand)
• Gene: Siglecg
• Gene Name: sialic acid binding Ig-like lectin G
• Synonym(s): mSiglec-G, A630096C01Rik
• Chromosomal Location: 43,408,204-43,418,358 bp (+)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002] ; PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000005592]
• AlphaFold: Q80ZE3
• SMART Domains: Protein: ENSMUSP00000005592; Gene: ENSMUSG00000030468; AA Change: R123G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	27	139	5.21e-2	SMART
IG_like	148	232	8.97e0	SMART
IGc2	262	325	3.38e-10	SMART
IGc2	366	427	8.26e-5	SMART
low complexity region	473	480	N/A	INTRINSIC
transmembrane domain	545	564	N/A	INTRINSIC

• Predicted Effect: possibly damaging ; PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
  (Using ENSMUST00000005592)
• Meta Mutation Damage Score: 0.6898
• Is this an essential gene?: Probably nonessential (E-score: 0.077)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:31 PM by Diantha La Vine
• Record Created: 2019-01-17 11:52 AM by Bruce Beutler
• Record Posted: 2019-01-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_172900; MGI:2443630

Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (ENU)(3) Gene trapped(3) Targeted(3)

Phenotypic Description

Figure 1. Sherando mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Sherando phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6562, some of which showed increased frequencies of B1 cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased B1 cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R6562. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. The increased B1 cell frequency phenotype was linked by continuous variable mapping to a mutation in Siglecg: an A to G transition at base pair 43,409,057 (v38) on chromosome 7, or base pair 865 in the GenBank genomic region NC_000073. The mutation in Siglecg was presumed causative as the B1 cell phenotype in Sherando mimics that of other Siglecg mutant alleles (see Shenandoah). Linkage was found with an additive model of inheritance, wherein four variant homozygotes and 20 heterozygous mice departed phenotypically from 15 homozygous reference mice with a P value of 4.569 x 10^-5 (Figure 2). 

The mutation corresponds to residue 512 in the mRNA sequence NM_172900 within exon 3 of 12 total exons.

497 TTCTTCCGGATGGAGAGAGGATTTGAGAGATTC 118 -F--F--R--M--E--R--G--F--E--R--F-

The mutated nucleotide is indicated in red. The mutation results in an arginine to glycine substitution at position 123 (R123G) in the Siglec-G protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.636).

Protein Prediction

Figure 6. Domain organization of Siglec-G. The Sherando mutation results in an arginine to glycine substitution at position 123 (R123G). Other mutations found in the Siglec-G protein are shown in red. Click on each mutation for more information.

Siglec-G (Siglec-10 in humans) is a member of the CD33-related Siglec (sialic acid–binding immunoglobulin‐like lectin) family of adhesion molecules. Siglecs specifically recognize sialic acids attached to the terminal regions of cell-surface glycoconjugates; Siglec-G preferentially binds α2,3-linked or α2,6-linked sialic acid (α2,3Sia or α2,6Sia).

Siglec-C is a type 1 transmembrane protein with a signal peptide, a sialic-binding V-set Ig-like domain, three C2-set Ig-like domains, a transmembrane domain, and a cytoplasmic tail with two putative immune receptor tyrosine-based inhibitory motifs (ITIMs) and a Grb-2 binding motif (Figure 3) (1).

The Sherando mutation results in an arginine to glycine substitution at position 123 (R123G) in the Siglec-G protein; amino acid 123 is within the V-type Ig domain.

For more information about Siglecg, please see the record Shenandoah.

Background

Siglec-G/-10 is one of two Siglecs expressed by B cells (the other being CD22; see the record for well), and was originally identified as a B cell-associated adhesion protein that functions in the regulation of B cell activation [reviewed by (2)]. Siglec-G/-10 is a B1 cell inhibitory receptor that inhibits B cell receptor-associated NF-κB and calcium signaling, subsequently controlling the expansion and survival of B1 cells (1;3-5). The mechanism by which Siglec-G/-10 functions as an inhibitory receptor is unknown.

Siglecg^-/- mice have increased levels of serum IgM and produce more IgM autoantibodies than wild-type mice (1;3). Over time, the Siglecg^-/- mice develop B-cell lymphoproliferative disorders, including diffuse large B-cell lymphoma, follicular lymphoma, medium-to-large B-cell monomorphic lymphoma and atypical lymphoproliferations (6). Older Siglecg^-/- mice also exhibited an autoimmune phenotype with increased autoantibody levels and mild glomerulonephritis as well as increased numbers of plasma cells, germinal center B cells, and activated CD4 T cells (7;8).

Siglecg^-/- mice exhibited increased numbers of B-1 (B-1a and B-1b) B cells due to reduced spontaneous apoptosis and increased life spans of the cells (1;3-5). The increased B1 cell frequency phenotype observed in the Sherando mice indicates loss of Siglec-G-associated function.

Primers

PCR Primer
Sherando_pcr_F: CCTGAGGGAAAATGGCTTAACC
Sherando_pcr_R: TACCAATCCTGTGACTCCAGC

Sequencing Primer
Sherando_seq_F: ATGGCTACTGGTTCAAAGGCATC
Sherando_seq_R: CGGCTCCTCCCAGAAGTAGTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 7, + strand):

1   cctgagggaa aatggcttaa ccgttcccca ctttatggct actggttcaa aggcatcaga
61  aaaccatcac tttcatttcc agtggccaca aataacaaag ataaagtgtt agaatgggaa
121 gcccgagggc gcttccagct cttgggggat atctctaaaa agaactgttc cttgctaatc
181 aaagatgttc agtggggaga ctcaacaaac tatttcttcc ggatggagag aggatttgag
241 agattcagtt tcaaggagga gttcaggcta caagtggaag gtaagagttg tagacatagc
301 agggaacctt ggtctctcac tgggggaggg acagtggaag ataaactgtg atgcaaagaa
361 gactacttct gggaggagcc gctggagtca caggattggt a

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Hoffmann, A., Kerr, S., Jellusova, J., Zhang, J., Weisel, F., Wellmann, U., Winkler, T. H., Kneitz, B., Crocker, P. R., and Nitschke, L. (2007) Siglec-G is a B1 Cell-Inhibitory Receptor that Controls Expansion and Calcium Signaling of the B1 Cell Population. Nat Immunol. 8, 695-704.

  2. Nitschke, L. (2009) CD22 and Siglec-G: B-Cell Inhibitory Receptors with Distinct Functions. Immunol Rev. 230, 128-143.

  3. Ding, C., Liu, Y., Wang, Y., Park, B. K., Wang, C. Y., Zheng, P., and Liu, Y. (2007) Siglecg Limits the Size of B1a B Cell Lineage by Down-Regulating NFkappaB Activation. PLoS One. 2, e997.

  4. Hutzler, S., Ozgor, L., Naito-Matsui, Y., Klasener, K., Winkler, T. H., Reth, M., and Nitschke, L. (2014) The Ligand-Binding Domain of Siglec-G is Crucial for its Selective Inhibitory Function on B1 Cells. J Immunol. 192, 5406-5414.

  5. Jellusova, J., Duber, S., Guckel, E., Binder, C. J., Weiss, S., Voll, R., and Nitschke, L. (2010) Siglec-G Regulates B1 Cell Survival and Selection. J Immunol. 185, 3277-3284.

  6. Simonetti, G., Bertilaccio, M. T., Rodriguez, T. V., Apollonio, B., Dagklis, A., Rocchi, M., Innocenzi, A., Casola, S., Winkler, T. H., Nitschke, L., Ponzoni, M., Caligaris-Cappio, F., and Ghia, P. (2014) SIGLEC-G Deficiency Increases Susceptibility to Develop B-Cell Lymphoproliferative Disorders. Haematologica. 99, 1356-1364.

  7. Muller, J., Lunz, B., Schwab, I., Acs, A., Nimmerjahn, F., Daniel, C., and Nitschke, L. (2015) Siglec-G Deficiency Leads to Autoimmunity in Aging C57BL/6 Mice. J Immunol. 195, 51-60.

  8. Bokers, S., Urbat, A., Daniel, C., Amann, K., Smith, K. G., Espeli, M., and Nitschke, L. (2014) Siglec-G Deficiency Leads to More Severe Collagen-Induced Arthritis and Earlier Onset of Lupus-Like Symptoms in MRL/lpr Mice. J Immunol. 192, 2994-3002.