Mutagenetix > Incidental Mutation

Incidental Mutation 'R2358:Siglecg'

247011

Institutional Source

Beutler Lab

Gene Symbol

Siglecg

Ensembl Gene

ENSMUSG00000030468

Gene Name

sialic acid binding Ig-like lectin G

Synonyms

mSiglec-G, A630096C01Rik

MMRRC Submission

040340-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R2358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43408204-43418358 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43409422 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 200 (S200G)

Ref Sequence

ENSEMBL: ENSMUSP00000005592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005592]

AlphaFold

Q80ZE3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005592
AA Change: S200G

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: S200G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
IG	27	139	5.21e-2	SMART
IG_like	148	232	8.97e0	SMART
IGc2	262	325	3.38e-10	SMART
IGc2	366	427	8.26e-5	SMART
low complexity region	473	480	N/A	INTRINSIC
transmembrane domain	545	564	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124885

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131744

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154322

Meta Mutation Damage Score

0.3874

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	CGG	CG	5: 124,077,305		probably null	Het
Aif1l	T	A	2: 31,969,751	F94L	probably damaging	Het
Ankzf1	C	T	1: 75,195,251	H209Y	probably damaging	Het
Ate1	A	T	7: 130,516,165	M30K	probably damaging	Het
Cd27	A	G	6: 125,233,318	Y189H	probably damaging	Het
Cela1	A	G	15: 100,681,228	I183T	probably benign	Het
Copg2	A	T	6: 30,826,233	L259*	probably null	Het
Efcab7	T	A	4: 99,831,586		probably benign	Het
Fcrl5	A	G	3: 87,446,419	E357G	probably damaging	Het
Fzr1	C	T	10: 81,367,640		probably null	Het
Gm10696	G	A	3: 94,175,547	A319V	possibly damaging	Het
Gm10696	C	A	3: 94,175,548	A319S	possibly damaging	Het
Il12rb2	C	T	6: 67,298,195	A649T	probably damaging	Het
Itfg1	C	A	8: 85,738,129	V438F	probably damaging	Het
Jaml	A	C	9: 45,101,063	I283L	possibly damaging	Het
Kif28	A	T	1: 179,709,459	H486Q	probably damaging	Het
Lrch4	A	G	5: 137,638,548		probably benign	Het
Lrfn2	A	G	17: 49,071,160	E423G	possibly damaging	Het
Lrp4	T	A	2: 91,501,954	N1665K	probably benign	Het
Mrpl32	A	T	13: 14,610,580	V157E	probably damaging	Het
Mta3	A	G	17: 83,762,988	I193V	probably damaging	Het
Myom2	G	A	8: 15,112,018	V984I	possibly damaging	Het
Nedd4l	G	A	18: 65,209,719	V909I	possibly damaging	Het
Nlrp4a	A	G	7: 26,464,198	D930G	probably benign	Het
Olfr121	T	A	17: 37,752,380	C175*	probably null	Het
Olfr1351	T	C	10: 79,018,188	F289L	probably damaging	Het
Olfr74	A	T	2: 87,973,722	N314K	probably benign	Het
Ovch2	A	T	7: 107,794,915	H110Q	probably damaging	Het
Pcnx3	G	A	19: 5,683,339	Q155*	probably null	Het
Pcnx3	C	G	19: 5,683,340	L1F	probably null	Het
Pi4k2a	G	A	19: 42,090,692	R64Q	probably damaging	Het
Ptpn12	G	A	5: 20,998,692	P363S	probably damaging	Het
Rbm27	T	C	18: 42,292,112		probably benign	Het
Ripor3	A	G	2: 167,983,865		probably benign	Het
Rpl13-ps3	A	G	14: 58,893,816		noncoding transcript	Het
Sap18b	G	A	8: 95,825,563	R67H	probably benign	Het
Sdhb	T	C	4: 140,973,000	V137A	probably damaging	Het
Shmt2	T	C	10: 127,518,028	T459A	probably benign	Het
Slc6a15	T	G	10: 103,416,785	I603S	probably benign	Het
Smtn	A	T	11: 3,532,865		probably null	Het
Spata31d1a	G	A	13: 59,703,888	S142L	probably benign	Het
Spopl	C	T	2: 23,537,380	R221Q	probably damaging	Het
St5	A	T	7: 109,556,446	S366T	probably benign	Het
Strip1	A	G	3: 107,615,819	V633A	probably benign	Het
Sun2	A	G	15: 79,727,913	S522P	possibly damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Terb2	T	A	2: 122,198,432	C157S	probably benign	Het
Themis	T	A	10: 28,863,380	N615K	possibly damaging	Het
Tlnrd1	A	T	7: 83,882,280	D314E	probably benign	Het
Vmn1r205	T	A	13: 22,592,396	T179S	probably benign	Het
Vsig10l	G	A	7: 43,468,761	R689H	probably benign	Het
Wt1	G	A	2: 105,163,428		probably benign	Het
Zfp423	G	T	8: 87,780,551	A1034D	possibly damaging	Het
Zfy2	T	C	Y: 2,107,272	E454G	possibly damaging	Het
Zyg11a	G	T	4: 108,196,146	Q440K	possibly damaging	Het

Other mutations in Siglecg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00528:Siglecg	APN	7	43409057	missense	possibly damaging	0.64
IGL00556:Siglecg	APN	7	43411795	missense	probably benign	0.02
IGL01806:Siglecg	APN	7	43411464	splice site	probably null
IGL01947:Siglecg	APN	7	43408763	missense	probably benign	0.43
IGL02257:Siglecg	APN	7	43411904	missense	probably benign	0.00
IGL02410:Siglecg	APN	7	43408829	missense	probably damaging	0.99
IGL02454:Siglecg	APN	7	43408895	missense	probably benign	0.00
Chamonix	UTSW	7	43409422	missense	possibly damaging	0.91
Dollywood	UTSW	7	43411099	missense	probably damaging	1.00
glowworm	UTSW	7	43408579	missense	probably benign	0.04
Montblanc	UTSW	7	43411386	intron	probably benign
Shenandoah	UTSW	7	43408802	missense	probably damaging	0.99
shenandoah2	UTSW	7	43412017	missense	possibly damaging	0.82
Sherando	UTSW	7	43409057	missense	possibly damaging	0.64
Smokies	UTSW	7	43409279	missense	probably benign	0.02
IGL02988:Siglecg	UTSW	7	43418052	missense	probably damaging	1.00
R0134:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0225:Siglecg	UTSW	7	43411171	missense	probably damaging	1.00
R0480:Siglecg	UTSW	7	43411126	missense	probably benign	0.42
R1538:Siglecg	UTSW	7	43417889	missense	possibly damaging	0.53
R1681:Siglecg	UTSW	7	43408941	missense	probably benign	0.17
R4428:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4429:Siglecg	UTSW	7	43417926	missense	possibly damaging	0.84
R4736:Siglecg	UTSW	7	43417908	missense	probably benign	0.03
R4754:Siglecg	UTSW	7	43411871	intron	probably benign
R5017:Siglecg	UTSW	7	43411386	intron	probably benign
R5713:Siglecg	UTSW	7	43408802	missense	probably damaging	0.99
R5777:Siglecg	UTSW	7	43409413	missense	possibly damaging	0.80
R5892:Siglecg	UTSW	7	43412204	intron	probably benign
R6153:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6154:Siglecg	UTSW	7	43412017	missense	possibly damaging	0.82
R6331:Siglecg	UTSW	7	43408754	missense	possibly damaging	0.83
R6562:Siglecg	UTSW	7	43409057	missense	possibly damaging	0.64
R6749:Siglecg	UTSW	7	43408979	missense	probably benign	0.00
R7066:Siglecg	UTSW	7	43411742	missense	probably benign	0.40
R7884:Siglecg	UTSW	7	43409279	missense	probably benign	0.02
R8275:Siglecg	UTSW	7	43412468	missense	probably benign
R8554:Siglecg	UTSW	7	43408896	missense	probably benign	0.01
R8846:Siglecg	UTSW	7	43412518	missense	probably benign	0.02
R8873:Siglecg	UTSW	7	43418024	missense	probably benign	0.00
R8887:Siglecg	UTSW	7	43408584	missense	probably benign	0.18
R9012:Siglecg	UTSW	7	43411099	missense	probably damaging	1.00
R9032:Siglecg	UTSW	7	43411625	missense	probably benign	0.24
R9048:Siglecg	UTSW	7	43408579	missense	probably benign	0.04
R9085:Siglecg	UTSW	7	43411625	missense	probably benign	0.24
R9313:Siglecg	UTSW	7	43412432	missense	probably benign	0.03
R9320:Siglecg	UTSW	7	43409429	missense	probably benign	0.33
R9745:Siglecg	UTSW	7	43418052	missense	probably damaging	0.98
RF006:Siglecg	UTSW	7	43408864	nonsense	probably null
Z1177:Siglecg	UTSW	7	43412022	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAGGCTACAAGTGGAAGG -3'
(R):5'- AGCATGGAGTTGGGGAATTC -3'

Sequencing Primer
(F):5'- GAACCTTGGTCTCTCACTGGG -3'
(R):5'- GAGTTGGGGAATTCTCTACCTCC -3'

Posted On

2014-10-30