Incidental Mutation 'R6336:Akt3'
ID510739
Institutional Source Beutler Lab
Gene Symbol Akt3
Ensembl Gene ENSMUSG00000019699
Gene Namethymoma viral proto-oncogene 3
SynonymsD930002M15Rik, Nmf350, PKB gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R6336 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location177020073-177258203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 177031712 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 431 (D431G)
Ref Sequence ENSEMBL: ENSMUSP00000106790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019843] [ENSMUST00000111159] [ENSMUST00000111160]
Predicted Effect probably damaging
Transcript: ENSMUST00000019843
AA Change: D431G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019843
Gene: ENSMUSG00000019699
AA Change: D431G

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 467 6.37e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111159
AA Change: D431G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106789
Gene: ENSMUSG00000019699
AA Change: D431G

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111160
AA Change: D431G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106790
Gene: ENSMUSG00000019699
AA Change: D431G

DomainStartEndE-ValueType
PH 6 109 4.81e-16 SMART
S_TKc 148 405 3.53e-106 SMART
S_TK_X 406 475 2.61e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192402
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. Mice heterozygous for an ENU-induced mutation exhibit increased seizures (sporadic and induced) and increased brain weight and size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,183,483 P955Q possibly damaging Het
Adgrv1 T C 13: 81,385,981 N5827S probably benign Het
Anapc16 A T 10: 59,988,829 V76D possibly damaging Het
Ankib1 A T 5: 3,700,377 Y755* probably null Het
Ankrd6 A G 4: 32,860,411 S11P probably damaging Het
Card6 T A 15: 5,099,164 K917* probably null Het
Ccdc152 T C 15: 3,301,129 I21M probably damaging Het
Ccdc40 A G 11: 119,231,993 E207G possibly damaging Het
Clca3a2 G T 3: 144,806,478 A499E probably benign Het
Cntnap5b C T 1: 100,358,669 A383V probably benign Het
Ddo T C 10: 40,633,031 V89A probably damaging Het
Depdc5 T C 5: 32,964,507 probably null Het
Dlgap1 T A 17: 70,815,289 D904E probably damaging Het
Ephb4 T A 5: 137,372,085 L849H probably damaging Het
Fbxl13 A G 5: 21,523,547 probably null Het
Fer1l6 C A 15: 58,559,232 Y245* probably null Het
Foxred2 A G 15: 77,955,764 Y109H probably damaging Het
Gabarapl1 A G 6: 129,537,528 D43G probably benign Het
Gabrb1 A C 5: 72,029,898 E178A possibly damaging Het
Gbp11 A G 5: 105,325,489 Het
Gm31371 A G 8: 19,924,350 K242E unknown Het
Grin3b C A 10: 79,976,461 A845E probably damaging Het
Hoxd4 A G 2: 74,727,361 Y28C probably damaging Het
Igsf10 G A 3: 59,330,339 T807M probably benign Het
Kcnt1 A G 2: 25,888,755 probably null Het
Kdm5a C A 6: 120,398,978 T565K probably damaging Het
Map7d1 A G 4: 126,236,682 S412P probably damaging Het
Mok A G 12: 110,834,124 probably null Het
Mto1 A T 9: 78,473,835 I73F probably damaging Het
Mtss1l G A 8: 110,732,164 D310N probably damaging Het
Ncf2 T C 1: 152,834,070 Y393H probably damaging Het
Olfr1299 A G 2: 111,664,619 H131R possibly damaging Het
Olfr1317 A C 2: 112,142,406 I154L probably benign Het
Olfr1384 G T 11: 49,514,542 K301N probably damaging Het
Olfr272 A T 4: 52,911,459 C112S probably damaging Het
Olfr38 T C 6: 42,762,657 S202P probably damaging Het
Olfr67 T C 7: 103,788,245 T11A possibly damaging Het
Phxr2 T A 10: 99,126,090 probably benign Het
Rnf17 A G 14: 56,421,169 probably null Het
Serpinb9d T C 13: 33,194,694 M41T probably damaging Het
Slc12a5 T A 2: 164,992,464 probably null Het
Slc22a6 G A 19: 8,622,130 R331H probably benign Het
Spg11 G C 2: 122,112,959 probably null Het
Src T A 2: 157,457,155 V24E probably benign Het
Srgap1 A T 10: 121,925,941 Y101N probably benign Het
Vmn2r30 T A 7: 7,334,308 T110S probably benign Het
Vwa3a A G 7: 120,762,423 E119G possibly damaging Het
Whamm T A 7: 81,591,764 D274E probably damaging Het
Other mutations in Akt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Akt3 APN 1 177130967 splice site probably benign
IGL02348:Akt3 APN 1 177059386 missense probably damaging 0.99
IGL02394:Akt3 APN 1 177059419 missense probably damaging 1.00
IGL03005:Akt3 APN 1 177067227 missense probably damaging 1.00
R0114:Akt3 UTSW 1 177067251 missense probably damaging 1.00
R1403:Akt3 UTSW 1 177131110 splice site probably benign
R1452:Akt3 UTSW 1 177131067 missense possibly damaging 0.93
R1495:Akt3 UTSW 1 177103042 missense probably benign
R1961:Akt3 UTSW 1 177096995 missense probably damaging 0.97
R2062:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2064:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2066:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R2068:Akt3 UTSW 1 177102985 missense possibly damaging 0.93
R4155:Akt3 UTSW 1 177096977 missense possibly damaging 0.92
R4937:Akt3 UTSW 1 177050127 missense possibly damaging 0.89
R5097:Akt3 UTSW 1 177248688 missense probably benign 0.01
R5414:Akt3 UTSW 1 177050251 missense probably damaging 0.98
R6723:Akt3 UTSW 1 177050190 nonsense probably null
R6752:Akt3 UTSW 1 177050190 nonsense probably null
R6753:Akt3 UTSW 1 177050190 nonsense probably null
R6755:Akt3 UTSW 1 177050190 nonsense probably null
R6765:Akt3 UTSW 1 177050190 nonsense probably null
R6766:Akt3 UTSW 1 177050190 nonsense probably null
R6767:Akt3 UTSW 1 177050190 nonsense probably null
R6782:Akt3 UTSW 1 177050190 nonsense probably null
R6787:Akt3 UTSW 1 177050190 nonsense probably null
R6847:Akt3 UTSW 1 177031659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAAGTCTGTTCCTGCTGCTC -3'
(R):5'- ACCCTGTCTGCCTTACACAG -3'

Sequencing Primer
(F):5'- TAGGCAGTGCAAATTCTCACAG -3'
(R):5'- GGACGCACCTTCTAGTTGTTG -3'
Posted On2018-04-02