Incidental Mutation 'R6545:Harbi1'
ID521073
Institutional Source Beutler Lab
Gene Symbol Harbi1
Ensembl Gene ENSMUSG00000027243
Gene Nameharbinger transposase derived 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91710852-91721545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 91712295 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 34 (Y34D)
Ref Sequence ENSEMBL: ENSMUSP00000117640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028678] [ENSMUST00000076803] [ENSMUST00000090608] [ENSMUST00000111322] [ENSMUST00000128140] [ENSMUST00000140183] [ENSMUST00000142692]
Predicted Effect probably benign
Transcript: ENSMUST00000028678
SMART Domains Protein: ENSMUSP00000028678
Gene: ENSMUSG00000027244

DomainStartEndE-ValueType
Pfam:ATG13 77 195 1.5e-10 PFAM
low complexity region 252 269 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076803
SMART Domains Protein: ENSMUSP00000076081
Gene: ENSMUSG00000027244

DomainStartEndE-ValueType
Pfam:ATG13 17 195 1.1e-35 PFAM
low complexity region 386 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090608
AA Change: Y34D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000088098
Gene: ENSMUSG00000027243
AA Change: Y34D

DomainStartEndE-ValueType
Pfam:Plant_tran 122 309 6.6e-8 PFAM
Pfam:DDE_Tnp_4 148 300 1.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111322
AA Change: Y34D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106954
Gene: ENSMUSG00000027243
AA Change: Y34D

DomainStartEndE-ValueType
Pfam:DDE_Tnp_4 148 226 1.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122236
Predicted Effect probably damaging
Transcript: ENSMUST00000128140
AA Change: Y34D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000140183
AA Change: Y34D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000142692
AA Change: Y34D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000121420
Gene: ENSMUSG00000027243
AA Change: Y34D

DomainStartEndE-ValueType
Pfam:DDE_Tnp_4 148 234 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gga3 A G 11: 115,587,169 F531S possibly damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Harbi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Harbi1 APN 2 91712626 missense probably damaging 1.00
R0670:Harbi1 UTSW 2 91712535 missense probably damaging 1.00
R0673:Harbi1 UTSW 2 91712535 missense probably damaging 1.00
R3788:Harbi1 UTSW 2 91720607 missense probably benign 0.10
R4296:Harbi1 UTSW 2 91712755 missense possibly damaging 0.49
R7207:Harbi1 UTSW 2 91712445 missense probably damaging 1.00
R7324:Harbi1 UTSW 2 91720699 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTGTTGAATTCTGATACTTACTGCGC -3'
(R):5'- TCAGTGACATTTGCAACGCAG -3'

Sequencing Primer
(F):5'- CTTACTGCGCTGGGAAAAATTCG -3'
(R):5'- GACTCATAGAGGCCTGGCTAATTC -3'
Posted On2018-06-06