Incidental Mutation 'R6545:Gga3'
ID521128
Institutional Source Beutler Lab
Gene Symbol Gga3
Ensembl Gene ENSMUSG00000020740
Gene Namegolgi associated, gamma adaptin ear containing, ARF binding protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R6545 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115584255-115604051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115587169 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 531 (F531S)
Ref Sequence ENSEMBL: ENSMUSP00000138597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021085] [ENSMUST00000106508] [ENSMUST00000125097] [ENSMUST00000156173]
Predicted Effect probably benign
Transcript: ENSMUST00000019135
AA Change: F531S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740
AA Change: F531S

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021085
SMART Domains Protein: ENSMUSP00000021085
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 53 606 1.2e-181 PFAM
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106508
AA Change: F453S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740
AA Change: F453S

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123831
Predicted Effect probably benign
Transcript: ENSMUST00000125097
SMART Domains Protein: ENSMUSP00000118024
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
Pfam:VHS 3 106 3.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154832
Predicted Effect possibly damaging
Transcript: ENSMUST00000156173
AA Change: F531S

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740
AA Change: F531S

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele display decreased birth weight, slow postnatal weight gain, hypoglycemia, increased plasma levels of acid hydrolases, and partial neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago1 C T 4: 126,454,352 A58T possibly damaging Het
Ago4 T A 4: 126,512,018 Q366L probably benign Het
Card10 C A 15: 78,776,810 G950V probably damaging Het
Ceacam1 A T 7: 25,473,854 V303D probably damaging Het
Cfap54 C T 10: 92,836,457 R2917H probably benign Het
Cit A G 5: 115,846,434 S22G probably null Het
Cog4 A G 8: 110,880,945 E666G probably damaging Het
Crocc2 A G 1: 93,212,937 D1103G probably benign Het
Cttnbp2 A T 6: 18,405,279 probably null Het
Dctn3 T C 4: 41,723,084 E16G probably damaging Het
Dnah6 A G 6: 73,044,732 S3536P probably damaging Het
Eef2 T A 10: 81,181,114 I675N probably damaging Het
Gm19410 A G 8: 35,790,498 R697G possibly damaging Het
Gm3173 T A 14: 4,514,810 M18K possibly damaging Het
Gm35339 C T 15: 76,363,378 R1585C probably damaging Het
Gm5800 A T 14: 51,711,962 S175R possibly damaging Het
Gria2 T C 3: 80,741,144 K95R probably damaging Het
Gstm6 A G 3: 107,942,365 I76T probably damaging Het
Harbi1 T G 2: 91,712,295 Y34D probably damaging Het
Hectd2 C A 19: 36,587,378 Q20K probably benign Het
Inpp5f C A 7: 128,694,556 A250D possibly damaging Het
Irf9 T C 14: 55,605,227 F59L probably damaging Het
Itgam T A 7: 128,107,872 M625K probably damaging Het
Kcnh5 C T 12: 75,007,658 R504Q probably damaging Het
Lama2 T C 10: 27,176,797 T1389A probably benign Het
Lin54 T A 5: 100,485,137 probably null Het
Mettl23 A G 11: 116,849,216 D171G possibly damaging Het
Mgll A G 6: 88,825,703 N296S probably benign Het
Mpv17 T A 5: 31,144,697 probably benign Het
Myof A T 19: 37,942,297 M1001K possibly damaging Het
Myom1 A T 17: 71,082,305 Q850L probably benign Het
Olfr509 A T 7: 108,646,455 N40K probably damaging Het
Pias2 A G 18: 77,130,085 I328V possibly damaging Het
Polh G A 17: 46,182,759 P311S possibly damaging Het
Prss34 A T 17: 25,298,835 R61S probably benign Het
Rassf2 A T 2: 131,998,317 M280K probably damaging Het
Rpsa A G 9: 120,130,257 H47R probably benign Het
Rtp3 A G 9: 110,986,826 V219A possibly damaging Het
Smarcc2 T C 10: 128,484,128 I790T probably benign Het
Stag3 A G 5: 138,298,352 T491A possibly damaging Het
Svil C T 18: 5,108,621 H2007Y probably benign Het
Togaram1 T G 12: 64,978,207 C750G possibly damaging Het
Vmn2r13 A T 5: 109,156,940 probably null Het
Vmn2r4 A T 3: 64,406,356 D401E possibly damaging Het
Wsb1 A T 11: 79,251,055 D45E probably damaging Het
Zfp808 T A 13: 62,171,895 Y313N probably benign Het
Other mutations in Gga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gga3 APN 11 115591741 missense probably damaging 1.00
IGL01449:Gga3 APN 11 115589102 missense probably damaging 1.00
IGL03343:Gga3 APN 11 115592486 missense probably damaging 0.99
IGL03390:Gga3 APN 11 115586994 critical splice donor site probably null
R0049:Gga3 UTSW 11 115587089 nonsense probably null
R0133:Gga3 UTSW 11 115588979 splice site probably benign
R0411:Gga3 UTSW 11 115587433 missense probably damaging 1.00
R0432:Gga3 UTSW 11 115590524 missense probably damaging 1.00
R0865:Gga3 UTSW 11 115592459 missense probably damaging 1.00
R3852:Gga3 UTSW 11 115587542 missense probably benign 0.04
R4869:Gga3 UTSW 11 115586285 intron probably benign
R4878:Gga3 UTSW 11 115591321 missense probably damaging 1.00
R5380:Gga3 UTSW 11 115588431 missense probably damaging 1.00
R5527:Gga3 UTSW 11 115587436 missense probably damaging 0.98
R6805:Gga3 UTSW 11 115585762 missense probably damaging 1.00
R6967:Gga3 UTSW 11 115591276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATCGATTCCAGGGGCAC -3'
(R):5'- TTCTGGAAGAGGCCAAAGTG -3'

Sequencing Primer
(F):5'- ATTCCAGGGGCACATGGACAC -3'
(R):5'- TATATATAGGACCAAAGGGAGGCTTC -3'
Posted On2018-06-06