Mutagenetix > Incidental Mutation

Incidental Mutation 'R1270:Tff2'

151291

Institutional Source

Beutler Lab

Gene Symbol

Tff2

Ensembl Gene

ENSMUSG00000024028

Gene Name

trefoil factor 2 (spasmolytic protein 1)

Synonyms

SP, mSP

MMRRC Submission

039336-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R1270 (G1)

Quality Score

155

Status

Validated

Chromosome

Chromosomal Location

31360036-31363256 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 31363143 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000024826 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024826] [ENSMUST00000024826] [ENSMUST00000024826] [ENSMUST00000024826]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000024826

SMART Domains

Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
PD	29	76	1.44e-16	SMART
PD	79	125	6.94e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000024826

SMART Domains

Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
PD	29	76	1.44e-16	SMART
PD	79	125	6.94e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000024826

SMART Domains

Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
PD	29	76	1.44e-16	SMART
PD	79	125	6.94e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000024826

SMART Domains

Protein: ENSMUSP00000024826
Gene: ENSMUSG00000024028

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
PD	29	76	1.44e-16	SMART
PD	79	125	6.94e-19	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer and affect healing of the epithelium. The encoded protein inhibits gastric acid secretion. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased gastric proliferation, increased acid secretion, increased susceptibility to gastric ulceration after indomethacin administration, and altered regulation of genes involved in adaptive and immune responses in the pyloric antrum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	C	T	11: 94,248,210 (GRCm39)	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,765,118 (GRCm39)	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,188,988 (GRCm39)	L301V	probably benign	Het
Alg9	A	G	9: 50,698,872 (GRCm39)		probably benign	Het
Aspg	C	T	12: 112,082,881 (GRCm39)	T187I	probably damaging	Het
Bltp1	T	A	3: 37,006,333 (GRCm39)	H1662Q	probably damaging	Het
C4a	A	G	17: 35,033,505 (GRCm39)		noncoding transcript	Het
Cdh2	T	G	18: 16,760,614 (GRCm39)		probably benign	Het
Ceacam1	T	C	7: 25,165,739 (GRCm39)		probably null	Het
Cep250	G	A	2: 155,832,601 (GRCm39)	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 25,041,321 (GRCm39)	S248P	probably benign	Het
Dgkd	A	T	1: 87,861,847 (GRCm39)	M801L	probably damaging	Het
Edc4	A	G	8: 106,617,896 (GRCm39)	E1152G	possibly damaging	Het
Enkd1	A	G	8: 106,430,533 (GRCm39)	I334T	probably damaging	Het
Gli3	C	T	13: 15,898,329 (GRCm39)	A803V	probably benign	Het
Glrx3	A	G	7: 137,055,143 (GRCm39)	N95S	probably benign	Het
Ints2	C	T	11: 86,123,911 (GRCm39)	G626R	probably damaging	Het
Kank2	A	T	9: 21,684,056 (GRCm39)	N724K	probably damaging	Het
Kctd20	A	G	17: 29,185,905 (GRCm39)	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,443,252 (GRCm39)	E645G	probably damaging	Het
Mrgpra9	A	T	7: 46,902,531 (GRCm39)		probably null	Het
Muc1	T	A	3: 89,139,414 (GRCm39)	Y605N	probably damaging	Het
Or4a47	C	T	2: 89,665,666 (GRCm39)	V208M	possibly damaging	Het
Or8g17	A	C	9: 38,930,543 (GRCm39)	I98R	possibly damaging	Het
Prx	T	A	7: 27,218,355 (GRCm39)	I952N	probably damaging	Het
Shf	G	A	2: 122,199,163 (GRCm39)	P51S	probably damaging	Het
Skint5	A	T	4: 113,799,856 (GRCm39)	Y90*	probably null	Het
Swt1	A	T	1: 151,260,142 (GRCm39)	N752K	probably benign	Het
Taar1	T	C	10: 23,796,431 (GRCm39)	V43A	probably damaging	Het
Tenm2	T	C	11: 35,932,486 (GRCm39)	N1702D	probably damaging	Het
Trim2	G	A	3: 84,074,984 (GRCm39)	A686V	probably damaging	Het
Ube2q2l	A	T	6: 136,378,785 (GRCm39)	I15N	probably damaging	Het

Other mutations in Tff2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01434:Tff2	APN	17	31,362,240 (GRCm39)	splice site	probably null
IGL01486:Tff2	APN	17	31,361,316 (GRCm39)	missense	probably benign	0.37
R2054:Tff2	UTSW	17	31,362,199 (GRCm39)	missense	probably benign	0.02
R2107:Tff2	UTSW	17	31,361,256 (GRCm39)	missense	possibly damaging	0.50
R6163:Tff2	UTSW	17	31,363,152 (GRCm39)	missense	probably benign	0.25
R6754:Tff2	UTSW	17	31,363,207 (GRCm39)	missense	probably benign	0.06
R7187:Tff2	UTSW	17	31,361,200 (GRCm39)	missense	probably damaging	1.00
R8899:Tff2	UTSW	17	31,362,113 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCAGGCTGACACCTGTAGACATAG -3'
(R):5'- GGGACAGTTATCAGGGCCATTGAG -3'

Sequencing Primer
(F):5'- GCCCTTCTGAATAAGAGATTCTGG -3'
(R):5'- TTATCAGGGCCATTGAGCAAAC -3'

Posted On

2014-01-29