Mutagenetix > Incidental Mutations

Incidental Mutation 'R1270:Kank2'

151279

Institutional Source

Beutler Lab

Gene Symbol

Kank2

Ensembl Gene

ENSMUSG00000032194

Gene Name

KN motif and ankyrin repeat domains 2

Synonyms

Ankrd25

MMRRC Submission

039336-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R1270 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21766784-21798744 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21772760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 724 (N724K)

Ref Sequence

ENSEMBL: ENSMUSP00000034717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000216008]

AlphaFold

Q8BX02

Predicted Effect

probably damaging
Transcript: ENSMUST00000034717
AA Change: N724K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194
AA Change: N724K

Domain	Start	End	E-Value	Type
Pfam:KN_motif	31	69	9.6e-26	PFAM
low complexity region	139	157	N/A	INTRINSIC
coiled coil region	213	229	N/A	INTRINSIC
coiled coil region	284	316	N/A	INTRINSIC
low complexity region	324	343	N/A	INTRINSIC
low complexity region	457	470	N/A	INTRINSIC
ANK	658	688	6.36e-3	SMART
ANK	692	725	7.29e2	SMART
ANK	730	759	4.97e-5	SMART
ANK	763	793	3.85e-2	SMART
ANK	797	825	1.06e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000216008

Meta Mutation Damage Score

0.3743

Coding Region Coverage

1x: 98.9%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KN motif and ankyrin repeat domains (KANK) family of proteins, which play a role in cytoskeletal formation by regulating actin polymerization. The encoded protein functions in the sequestration of steroid receptor coactivators and possibly other proteins. Mutations in this gene are associated with impaired kidney podocyte function and nephrotic syndrome, and keratoderma and woolly hair. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,952,184	H1662Q	probably damaging	Het
Abcc3	C	T	11: 94,357,384	R1129Q	probably damaging	Het
Adam7	T	A	14: 68,527,669	K93M	probably damaging	Het
Aldh1a2	T	G	9: 71,281,706	L301V	probably benign	Het
Alg9	A	G	9: 50,787,572		probably benign	Het
Aspg	C	T	12: 112,116,447	T187I	probably damaging	Het
C4a	A	G	17: 34,814,528		noncoding transcript	Het
Cdh2	T	G	18: 16,627,557		probably benign	Het
Ceacam1	T	C	7: 25,466,314		probably null	Het
Cep250	G	A	2: 155,990,681	V1509I	probably benign	Het
D130043K22Rik	T	C	13: 24,857,338	S248P	probably benign	Het
Dgkd	A	T	1: 87,934,125	M801L	probably damaging	Het
E330021D16Rik	A	T	6: 136,401,787	I15N	probably damaging	Het
Edc4	A	G	8: 105,891,264	E1152G	possibly damaging	Het
Enkd1	A	G	8: 105,703,901	I334T	probably damaging	Het
Gli3	C	T	13: 15,723,744	A803V	probably benign	Het
Glrx3	A	G	7: 137,453,414	N95S	probably benign	Het
Ints2	C	T	11: 86,233,085	G626R	probably damaging	Het
Kctd20	A	G	17: 28,966,931	D416G	possibly damaging	Het
Lmtk3	A	G	7: 45,793,828	E645G	probably damaging	Het
Mrgpra9	A	T	7: 47,252,783		probably null	Het
Muc1	T	A	3: 89,232,107	Y605N	probably damaging	Het
Olfr1256	C	T	2: 89,835,322	V208M	possibly damaging	Het
Olfr146	A	C	9: 39,019,247	I98R	possibly damaging	Het
Prx	T	A	7: 27,518,930	I952N	probably damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Skint5	A	T	4: 113,942,659	Y90*	probably null	Het
Swt1	A	T	1: 151,384,391	N752K	probably benign	Het
Taar1	T	C	10: 23,920,533	V43A	probably damaging	Het
Tenm2	T	C	11: 36,041,659	N1702D	probably damaging	Het
Tff2	C	T	17: 31,144,169		probably null	Het
Trim2	G	A	3: 84,167,677	A686V	probably damaging	Het

Other mutations in Kank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Kank2	APN	9	21780479	splice site	probably benign
IGL01574:Kank2	APN	9	21794604	missense	probably damaging	1.00
IGL01624:Kank2	APN	9	21780380	missense	probably damaging	1.00
IGL02752:Kank2	APN	9	21795033	missense	probably damaging	1.00
IGL03116:Kank2	APN	9	21772764	missense	probably damaging	0.96
IGL03133:Kank2	APN	9	21795641	missense	probably null	0.82
IGL03384:Kank2	APN	9	21774578	missense	possibly damaging	0.82
PIT4515001:Kank2	UTSW	9	21794883	missense	probably benign
R0054:Kank2	UTSW	9	21774674	nonsense	probably null
R0480:Kank2	UTSW	9	21779899	missense	probably damaging	1.00
R1538:Kank2	UTSW	9	21774631	missense	probably damaging	0.99
R1574:Kank2	UTSW	9	21774575	missense	probably damaging	1.00
R1574:Kank2	UTSW	9	21774575	missense	probably damaging	1.00
R1602:Kank2	UTSW	9	21769837	missense	probably damaging	1.00
R1827:Kank2	UTSW	9	21795465	missense	probably damaging	1.00
R1941:Kank2	UTSW	9	21772866	missense	possibly damaging	0.69
R1976:Kank2	UTSW	9	21794561	missense	probably damaging	0.97
R2276:Kank2	UTSW	9	21769784	missense	probably damaging	1.00
R2278:Kank2	UTSW	9	21769784	missense	probably damaging	1.00
R2303:Kank2	UTSW	9	21769765	missense	probably benign	0.12
R4085:Kank2	UTSW	9	21795119	missense	probably damaging	1.00
R4163:Kank2	UTSW	9	21795568	missense	probably damaging	1.00
R4204:Kank2	UTSW	9	21795627	missense	probably damaging	1.00
R4461:Kank2	UTSW	9	21794745	nonsense	probably null
R4738:Kank2	UTSW	9	21774619	missense	probably damaging	1.00
R4811:Kank2	UTSW	9	21775747	missense	probably damaging	1.00
R4859:Kank2	UTSW	9	21779782	missense	probably benign	0.13
R5838:Kank2	UTSW	9	21795393	missense	probably damaging	0.99
R6449:Kank2	UTSW	9	21780562	missense	possibly damaging	0.68
R7131:Kank2	UTSW	9	21794679	missense	probably benign	0.02
R8724:Kank2	UTSW	9	21794621	missense	possibly damaging	0.68
R9040:Kank2	UTSW	9	21794819	missense	probably damaging	1.00
R9139:Kank2	UTSW	9	21770074	missense	probably damaging	1.00
Z1177:Kank2	UTSW	9	21795249	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACAGCCTGGAGTTAATGAAGGAG -3'
(R):5'- ACTGGCTATGCCTAAACAGAGGGAG -3'

Sequencing Primer
(F):5'- GTTATggggccagtgagc -3'
(R):5'- GCCAGCCTTGAGTCTGATG -3'

Posted On

2014-01-29