Incidental Mutation 'R1270:Kank2'
ID 151279
Institutional Source Beutler Lab
Gene Symbol Kank2
Ensembl Gene ENSMUSG00000032194
Gene Name KN motif and ankyrin repeat domains 2
Synonyms Ankrd25
MMRRC Submission 039336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R1270 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 21766784-21798744 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21772760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 724 (N724K)
Ref Sequence ENSEMBL: ENSMUSP00000034717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000216008]
AlphaFold Q8BX02
Predicted Effect probably damaging
Transcript: ENSMUST00000034717
AA Change: N724K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194
AA Change: N724K

DomainStartEndE-ValueType
Pfam:KN_motif 31 69 9.6e-26 PFAM
low complexity region 139 157 N/A INTRINSIC
coiled coil region 213 229 N/A INTRINSIC
coiled coil region 284 316 N/A INTRINSIC
low complexity region 324 343 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
ANK 658 688 6.36e-3 SMART
ANK 692 725 7.29e2 SMART
ANK 730 759 4.97e-5 SMART
ANK 763 793 3.85e-2 SMART
ANK 797 825 1.06e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216008
Meta Mutation Damage Score 0.3743 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KN motif and ankyrin repeat domains (KANK) family of proteins, which play a role in cytoskeletal formation by regulating actin polymerization. The encoded protein functions in the sequestration of steroid receptor coactivators and possibly other proteins. Mutations in this gene are associated with impaired kidney podocyte function and nephrotic syndrome, and keratoderma and woolly hair. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,952,184 H1662Q probably damaging Het
Abcc3 C T 11: 94,357,384 R1129Q probably damaging Het
Adam7 T A 14: 68,527,669 K93M probably damaging Het
Aldh1a2 T G 9: 71,281,706 L301V probably benign Het
Alg9 A G 9: 50,787,572 probably benign Het
Aspg C T 12: 112,116,447 T187I probably damaging Het
C4a A G 17: 34,814,528 noncoding transcript Het
Cdh2 T G 18: 16,627,557 probably benign Het
Ceacam1 T C 7: 25,466,314 probably null Het
Cep250 G A 2: 155,990,681 V1509I probably benign Het
D130043K22Rik T C 13: 24,857,338 S248P probably benign Het
Dgkd A T 1: 87,934,125 M801L probably damaging Het
E330021D16Rik A T 6: 136,401,787 I15N probably damaging Het
Edc4 A G 8: 105,891,264 E1152G possibly damaging Het
Enkd1 A G 8: 105,703,901 I334T probably damaging Het
Gli3 C T 13: 15,723,744 A803V probably benign Het
Glrx3 A G 7: 137,453,414 N95S probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kctd20 A G 17: 28,966,931 D416G possibly damaging Het
Lmtk3 A G 7: 45,793,828 E645G probably damaging Het
Mrgpra9 A T 7: 47,252,783 probably null Het
Muc1 T A 3: 89,232,107 Y605N probably damaging Het
Olfr1256 C T 2: 89,835,322 V208M possibly damaging Het
Olfr146 A C 9: 39,019,247 I98R possibly damaging Het
Prx T A 7: 27,518,930 I952N probably damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Skint5 A T 4: 113,942,659 Y90* probably null Het
Swt1 A T 1: 151,384,391 N752K probably benign Het
Taar1 T C 10: 23,920,533 V43A probably damaging Het
Tenm2 T C 11: 36,041,659 N1702D probably damaging Het
Tff2 C T 17: 31,144,169 probably null Het
Trim2 G A 3: 84,167,677 A686V probably damaging Het
Other mutations in Kank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Kank2 APN 9 21780479 splice site probably benign
IGL01574:Kank2 APN 9 21794604 missense probably damaging 1.00
IGL01624:Kank2 APN 9 21780380 missense probably damaging 1.00
IGL02752:Kank2 APN 9 21795033 missense probably damaging 1.00
IGL03116:Kank2 APN 9 21772764 missense probably damaging 0.96
IGL03133:Kank2 APN 9 21795641 missense probably null 0.82
IGL03384:Kank2 APN 9 21774578 missense possibly damaging 0.82
PIT4515001:Kank2 UTSW 9 21794883 missense probably benign
R0054:Kank2 UTSW 9 21774674 nonsense probably null
R0480:Kank2 UTSW 9 21779899 missense probably damaging 1.00
R1538:Kank2 UTSW 9 21774631 missense probably damaging 0.99
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1602:Kank2 UTSW 9 21769837 missense probably damaging 1.00
R1827:Kank2 UTSW 9 21795465 missense probably damaging 1.00
R1941:Kank2 UTSW 9 21772866 missense possibly damaging 0.69
R1976:Kank2 UTSW 9 21794561 missense probably damaging 0.97
R2276:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2278:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2303:Kank2 UTSW 9 21769765 missense probably benign 0.12
R4085:Kank2 UTSW 9 21795119 missense probably damaging 1.00
R4163:Kank2 UTSW 9 21795568 missense probably damaging 1.00
R4204:Kank2 UTSW 9 21795627 missense probably damaging 1.00
R4461:Kank2 UTSW 9 21794745 nonsense probably null
R4738:Kank2 UTSW 9 21774619 missense probably damaging 1.00
R4811:Kank2 UTSW 9 21775747 missense probably damaging 1.00
R4859:Kank2 UTSW 9 21779782 missense probably benign 0.13
R5838:Kank2 UTSW 9 21795393 missense probably damaging 0.99
R6449:Kank2 UTSW 9 21780562 missense possibly damaging 0.68
R7131:Kank2 UTSW 9 21794679 missense probably benign 0.02
R8724:Kank2 UTSW 9 21794621 missense possibly damaging 0.68
R9040:Kank2 UTSW 9 21794819 missense probably damaging 1.00
R9139:Kank2 UTSW 9 21770074 missense probably damaging 1.00
Z1177:Kank2 UTSW 9 21795249 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGCCTGGAGTTAATGAAGGAG -3'
(R):5'- ACTGGCTATGCCTAAACAGAGGGAG -3'

Sequencing Primer
(F):5'- GTTATggggccagtgagc -3'
(R):5'- GCCAGCCTTGAGTCTGATG -3'
Posted On 2014-01-29